Produced:Article Title: Mitochondrial Ca 2+ controls pancreatic cancer growth and metastasis by regulating epithelial cell plasticity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies beta Tubulin Monoclonal Antibody Invitrogen 32–2600; RRID: AB_2533072 MCU (D2Z3B) Rabbit mAb Cell Signaling 14997; RRID: AB_2721812 Vimentin (D21H3) XP® Rabbit mAb Cell Signaling 5741; RRID: AB_10695459 N-Cadherin (D4R1H) XP® Rabbit mAb Cell Signaling 13116; RRID: AB_2687616 E-Cadherin (24E10) Rabbit mAb Cell Signaling 3195; RRID: AB_2291471 Snail (C15D3) Rabbit mAb Cell Signaling 3879; RRID: AB_2255011 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling 7074; RRID: AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling 7076; RRID: AB_330924 HIF-1α (D1S7W) XP® Rabbit mAb Cell Signaling 36169; RRID: AB_2799095 Nrf2 (D1Z9C) XP® Rabbit mAb Cell Signaling 12721: RRID: AB_2715528 Anti-MCU antibody produced in rabbit Sigma Aldrich HPA016480; RRID: AB_2071893 Monoclonal Anti-mouse E-cadherin (Clone ECCD-2) Takara M108; RRID: AB_2895157 Rabbit anti-Ki67 antibody SP6 Abcam ab16667; RRID: AB_302459 Caspase-3 (D3R6Y) Rabbit mAb Cell Signaling 14220: RRID: AB_2798429 Cleaved Caspase 3 (Asp175) (5A1E) Rabbit mAb Cell Signaling 9664: RRID: AB_2070042 Anti-Green Fluorescent Protein Antibody (Goat Polyclonal) Abcam ab6673; RRID: AB_305643 Tgf beta-1,2,3 Monoclonal Antibody (1D11), Unconjugated, Species Reactivity: Human, Host: Mouse/IgG1 Thermo Fisher Scientific MA5-23795; RRID: AB_2609812 Chemicals, peptides, and recombinant proteins Triton X-100 Sigma T9284 TGF beta Millipore Sigma SRP3171 Basic Fibroblast Growth Factor Sigma Aldrich F0291 B-27 supplement Life Technologies 17504–044 Epidermal Growth Factor Sigma Aldrich E5036 Insulin Life Technologies A11429IJ Bovine Serum Albumin Sigma Aldrich A9576 Aggrewell Antiadherence solution Stem Cell Technologies 07010 cOmplete Mini protease inhibitor cocktail, EDTA free Roche 11836170001 NuPAGE 4–12% bis/tris mini protein gels Invitrogen NP0321-0323 Immobilon P PVDF membrane Millipore IPVH00010 Precision Plus Dual Color Standard Biorad 161–0374 NuPAGETM MES SDS Running Buffer (20X) Invitrogen NP0002 Puromycin dihydrochloride, 10 mg/mL Life Technologies A11138-03 Geneticin Invitrogen 10131035 Lipofectamine 3000 Thermo Fisher Scientific L3000001 Fluoromount-GTM Mounting Medium with DAPI Invitrogen 00-4959-52 (Continued on next page) Cell Reports 44, 115627, May 27, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Mouse Cytokine/Chemokine 32-Plex Discovery Assay® Array Eve Technologies MD32 Mouse TGF beta 1 ELISA kit Abcam ab119557 RNeasy Mini kit Qiagen 74104 ECMatrix Cell Invasion Assay 8 uM Millipore Sigma ECM550 Corning® 6.5 mm Transwell® with 8.0 μm Pore Polyester Membrane Insert, Sterile Corning 3464 Deposited data Mitochondrial Ca2+ controls pancreatic cancer growth and metastasis by regulating epithelial cell plasticity Weissenrieder JS, Foskett JK GEO: GSE287625 Expression Analysis of Normal and Neoplastic Mouse Pancreatic Ductal Organoids Tuveson DA, Baker LA GEO: GSE63348 Analysis of donor pancreata defines the transcriptomic signature and microenvironment of early neoplastic lesions (reanalyzed from dbGap phs002071 Pasca di Magliano M, Carpenter ES, Elhossiny AM GEO: GSE229413 Experimental models: Cell lines Panc-1 ATCC CRL-1469 HPDE Kerafast H6c7 MiaPaCa-2 ATCC CRL-1420 2838.c3 murine KPCY line Stanger lab Stanger lab 1151 murine KPCY-McuCre-KO This paper This paper 2838.c3 murine KPCY-McuWT pLentiCRISPR-EV clones 15&22 This paper This paper 2838.c3 murine KPCY-McuCRISPR-KO clones 17 and 42 This paper This paper 1151 murine KPCY-McuCre-KO empty vector clones 1 & 3 This paper This paper 1151 murine KPCY-Mcurescue clones 2,3,4,5,6, & 9 This paper This paper 2838.c3 KPCY-McuWT EV cl 15 + pCDH-EV This paper This paper 2838.c3 KPCY-McuWT EV cl 15 + pCDHSnail This paper This paper Experimental models: Organisms/strains C57BL/6J Mice Jackson Laboratories 000664 Pdx1-Cre;KrasG12D/+;Tp53R172H/+;R26LslYfp/Lsl-Yfp;Mcufl/fl mice in C57BL/6J background This paper This paper Recombinant DNA pCMV6-A-MCU-V5-His-puro Generated in lab DOI: pnas.2005976117 pCMV6-A-EV-puro Origene PS100025 pCDH-Snail-blasti N/A pCDH-EV-blasti pLentiCRISPR V2-sgMCU Mohamed Trebak lab N/A pLentiCRISPR V2-EV Addgene 52961 Software and algorithms Prism GraphPad N/A
Article Title: PI5P4Kα promotes glucose and iron acquisition to support metabolic fitness in pancreatic cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PIP4K2A (D83C1) Rabbit mAb Cell signaling Technology Cat# 5527; RRID:AB_2722636 PARP (46D11) Rabbit mAb Cell signaling Technology Cat# 9532; RRID:AB_659884 p62/SQSTM1 (2C11) mouse mAb Abnova Cat# H00008878-M01; RRID:AB_437085 LC3A/B (D3U4C) Rabbit mAb Cell signaling Technology Cat# 12741; RRID:AB_2617131 Tubulin (TUBA1) mouse mAb Millipore Sigma Cat# T6199; RRID:AB_477583 Phospho-histone H3 (Ser10) Rabbit mAb Cell signaling Technology Cat# 9701; RRID:AB_331535 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell signaling Technology Cat# 9664; RRID:AB_2070042 IRDye® 680LT Goat anti-mouse IgG secondary Ab LICORbio Cat# 926–68020; RRID:AB_2687826 IRDye® 800CW Goat anti-Rabbit IgG secondary Ab LICORbio Cat# 926–32211; RRID:AB_621843 Glut1 (E4S6I) Rabbit mAb Cell signaling Technology Cat# 73015; RRID:AB_3064908 ASNS Polyclonal antibody Proteintech Cat#14681-1-AP; RRID: AB_2060119 CD71 antibody, anti-human, PE, REAfinityTM, REA902 | AC102 Miltenyi Biotec Cat#130-115-029; RRID:AB_2726859 Bacterial and virus strains Lentivirus Produced using pLKO.1-puro shRNA system in HEK293T cells N/A DH5α E. coli Zymo research Cat# T3007 Biological samples Mouse pancreatic tumors Sanford Burnham Prebys Medical Discovery Institute vivarium N/A Human PDAC tissue samples University of Bern N/A Chemicals, peptides, and recombinant proteins Polybrene Santa Cruz Biotechnology Cat# SC134220 Formaldehyde 37% RICCA chemical company Cat# RSOF0010 Crystal violet Millipore Sigma Cat# C0775 Emricasan MedKoo Biosciences Cat# 510230 Tetramethylrhodamine, Ethyl Ester, Perchlorate (TMRE) ThermoFisher Scientific Cat# T669 Transferrin (human) CF® 594 Conjugate Biotium Cat# #00084 DAPI (4′,6-Diamidino-2Phenylindole, Dilactate) BioLegend Cat# 422801 Hoechst 33342 MP Biomedicals Cat# 0219030525 Doxycycline hyclate Millipore Sigma Cat# D9891 Sodium L-lactate Millipore Sigma Cat# 71718 Sodium pyruvate ThermoFisher Scientific Cat# 11360070 Dimethyl 2-oxoglutarate Millipore Sigma Cat# 349631 Dimethyl DL-Glutamate (hydrochloride) Cayman chemical Cat# 18602 Ammonium iron(III) citrate (FAC) Millipore Sigma Cat# F5879 Ferrostatin-1 Fisher Scientific Cat# 50-225-9214 Sodium citrate VWR Cat# 0101 Bafilomycin A1 Selleckchem Cat# S1413 DMEM with L-Glutamine and 4.5g/L glucose; without sodium pyruvate Corning Cat# 10017CV (Continued on next page) 16 Cell Reports 44, 116199, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mouse: Nude (Foxn1nu) The Jackson Laboratory Cat# 002019; RRID:IMSR_JAX:002019 Oligonucleotides PIP4K2A-F Custom DNA Oligos CGTAGCGCAGAAAGTGAAGC PIP4K2A-R Custom DNA Oligos GGCTCGGCATGTTTTCTTTGT Recombinant DNA pLKO.1 puro Addgene Cat# 8453 psPAX2 Addgene Cat# 12260 pVSV-G Addgene Cat# 138479 pCL-Ampho Novus biologicals Cat# NBP2-29541 pLKO.1 shSCR Addgene Cat# 17920 pLKO.1-puro-sh α1 Lab-generated sh α#1-TRCN0000220609; 5′- CCTCGGACAGACATGAACATT-3′ pLKO.1-puro-sh α2 Lab-generated sh α#2 -TRCN0000195145; 5′- CCAGCATCGTTCTAGCTATTT-3′ Tet-pLKO-puro Addgene Cat# 21915 Tet-pLKO-puro-sh α1 Lab-generated sh α#1-TRCN0000220609; 5′- CCTCGGACAGACATGAACATT-3′ Tet-pLKO-puro-sh α2 Lab-generated sh α#2 -TRCN0000195145; 5′- CCAGCATCGTTCTAGCTATTT-3′ mCherry-eGFP-LC3B NovoPro Cat# V012182 Software and algorithms GraphPad Prism version 10.0.0 GraphPad software RRID:SCR_002798; https://www.graphpad.com Fiji (ImageJ) NIH RRID:SCR_002285; https://fiji.sc BioTek Gen5 Agilent Technologies RRID:SCR_017317; https://www.agilent.com/en/ support/biotek-software-releases FACSDiVa v8.0.2.
Recombinant:Article Title: Mitochondrial Ca 2+ controls pancreatic cancer growth and metastasis by regulating epithelial cell plasticity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies beta Tubulin Monoclonal Antibody Invitrogen 32–2600; RRID: AB_2533072 MCU (D2Z3B) Rabbit mAb Cell Signaling 14997; RRID: AB_2721812 Vimentin (D21H3) XP® Rabbit mAb Cell Signaling 5741; RRID: AB_10695459 N-Cadherin (D4R1H) XP® Rabbit mAb Cell Signaling 13116; RRID: AB_2687616 E-Cadherin (24E10) Rabbit mAb Cell Signaling 3195; RRID: AB_2291471 Snail (C15D3) Rabbit mAb Cell Signaling 3879; RRID: AB_2255011 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling 7074; RRID: AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling 7076; RRID: AB_330924 HIF-1α (D1S7W) XP® Rabbit mAb Cell Signaling 36169; RRID: AB_2799095 Nrf2 (D1Z9C) XP® Rabbit mAb Cell Signaling 12721: RRID: AB_2715528 Anti-MCU antibody produced in rabbit Sigma Aldrich HPA016480; RRID: AB_2071893 Monoclonal Anti-mouse E-cadherin (Clone ECCD-2) Takara M108; RRID: AB_2895157 Rabbit anti-Ki67 antibody SP6 Abcam ab16667; RRID: AB_302459 Caspase-3 (D3R6Y) Rabbit mAb Cell Signaling 14220: RRID: AB_2798429 Cleaved Caspase 3 (Asp175) (5A1E) Rabbit mAb Cell Signaling 9664: RRID: AB_2070042 Anti-Green Fluorescent Protein Antibody (Goat Polyclonal) Abcam ab6673; RRID: AB_305643 Tgf beta-1,2,3 Monoclonal Antibody (1D11), Unconjugated, Species Reactivity: Human, Host: Mouse/IgG1 Thermo Fisher Scientific MA5-23795; RRID: AB_2609812 Chemicals, peptides, and recombinant proteins Triton X-100 Sigma T9284 TGF beta Millipore Sigma SRP3171 Basic Fibroblast Growth Factor Sigma Aldrich F0291 B-27 supplement Life Technologies 17504–044 Epidermal Growth Factor Sigma Aldrich E5036 Insulin Life Technologies A11429IJ Bovine Serum Albumin Sigma Aldrich A9576 Aggrewell Antiadherence solution Stem Cell Technologies 07010 cOmplete Mini protease inhibitor cocktail, EDTA free Roche 11836170001 NuPAGE 4–12% bis/tris mini protein gels Invitrogen NP0321-0323 Immobilon P PVDF membrane Millipore IPVH00010 Precision Plus Dual Color Standard Biorad 161–0374 NuPAGETM MES SDS Running Buffer (20X) Invitrogen NP0002 Puromycin dihydrochloride, 10 mg/mL Life Technologies A11138-03 Geneticin Invitrogen 10131035 Lipofectamine 3000 Thermo Fisher Scientific L3000001 Fluoromount-GTM Mounting Medium with DAPI Invitrogen 00-4959-52 (Continued on next page) Cell Reports 44, 115627, May 27, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Mouse Cytokine/Chemokine 32-Plex Discovery Assay® Array Eve Technologies MD32 Mouse TGF beta 1 ELISA kit Abcam ab119557 RNeasy Mini kit Qiagen 74104 ECMatrix Cell Invasion Assay 8 uM Millipore Sigma ECM550 Corning® 6.5 mm Transwell® with 8.0 μm Pore Polyester Membrane Insert, Sterile Corning 3464 Deposited data Mitochondrial Ca2+ controls pancreatic cancer growth and metastasis by regulating epithelial cell plasticity Weissenrieder JS, Foskett JK GEO: GSE287625 Expression Analysis of Normal and Neoplastic Mouse Pancreatic Ductal Organoids Tuveson DA, Baker LA GEO: GSE63348 Analysis of donor pancreata defines the transcriptomic signature and microenvironment of early neoplastic lesions (reanalyzed from dbGap phs002071 Pasca di Magliano M, Carpenter ES, Elhossiny AM GEO: GSE229413 Experimental models: Cell lines Panc-1 ATCC CRL-1469 HPDE Kerafast H6c7 MiaPaCa-2 ATCC CRL-1420 2838.c3 murine KPCY line Stanger lab Stanger lab 1151 murine KPCY-McuCre-KO This paper This paper 2838.c3 murine KPCY-McuWT pLentiCRISPR-EV clones 15&22 This paper This paper 2838.c3 murine KPCY-McuCRISPR-KO clones 17 and 42 This paper This paper 1151 murine KPCY-McuCre-KO empty vector clones 1 & 3 This paper This paper 1151 murine KPCY-Mcurescue clones 2,3,4,5,6, & 9 This paper This paper 2838.c3 KPCY-McuWT EV cl 15 + pCDH-EV This paper This paper 2838.c3 KPCY-McuWT EV cl 15 + pCDHSnail This paper This paper Experimental models: Organisms/strains C57BL/6J Mice Jackson Laboratories 000664 Pdx1-Cre;KrasG12D/+;Tp53R172H/+;R26LslYfp/Lsl-Yfp;Mcufl/fl mice in C57BL/6J background This paper This paper Recombinant DNA pCMV6-A-MCU-V5-His-puro Generated in lab DOI: pnas.2005976117 pCMV6-A-EV-puro Origene PS100025 pCDH-Snail-blasti N/A pCDH-EV-blasti pLentiCRISPR V2-sgMCU Mohamed Trebak lab N/A pLentiCRISPR V2-EV Addgene 52961 Software and algorithms Prism GraphPad N/A
Article Title: CD4 + anti-TGF-β CAR T cells and CD8 + conventional CAR T cells exhibit synergistic antitumor effects.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human CD25 Antibody R&D systems Cat# AF-223-NA RRID: AB_354408 Purified anti-human CXCR3 (Maxpar Ready) Antibody Fluidigm Cat# 3163004B Purified anti-human CCR6 (Maxpar Ready) Antibody Fluidigm Cat# 3141003A Anti-Human CD45 (HI30)-89Y Fluidigm Cat# 3089003B TIGIT Monoclonal Antibody (MBSA43), Functional Grade, eBioscienceTM Thermo Cat# 16-9500-82 RRID: AB_10718831 FOXP3 Monoclonal Antibody (PCH101), Functional Grade, eBioscienceTM Thermo Cat# 14-4776-82 RRID: AB_467553 APC/Cyanine7 anti-human CD279 (PD-1) Antibody Biolegend Cat# 367416 RRID: AB_2616744 APC anti-human CD279 (PD-1) Antibody Biolegend Cat# 367406 RRID: AB_2566067 PE/Cyanine7 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369208 RRID: AB_2629835 PerCP/Cyanine5.5 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369216 RRID: AB_2910413 APC anti-human CD3 Antibody Biolegend Cat# 300439 RRID: AB_2562045 PE/Cyanine7 anti-human CD3 Antibody Biolegend Cat# 300420 RRID: AB_439781 APC/Cyanine7 anti-human CD4 Antibody Biolegend Cat# 317418 RRID: AB_571947 PE anti-human CD8 Antibody Biolegend Cat# 303804 RRID: AB_2860786 APC anti-human CD25 Antibody Biolegend Cat# 356110 RRID: AB_2561977 PE/Cyanine7 anti-human CD69 Antibody Biolegend Cat# 310912 RRID: AB_314847 APC anti-human CD69 Antibody Biolegend Cat# 310910 RRID: AB_314845 PE anti-human CD69 Antibody Biolegend Cat# 310906 RRID: AB_314841 PE anti-human NKG2D Antibody Biolegend Cat# 320806 RRID: AB_492960 APC anti-human MICA/B Antibody Biolegend Cat# 320908 RRID: AB_493196 Human ULBP-2/5/6 APC-conjugated Antibody R&D systems Cat# FAB1298A RRID: AB_2257142 Human Mesothelin APC-conjugated Antibody R&D systems Cat# FAB32652A RRID: AB_2298058 APC Mouse IgG1, k Isotype Ctrl Antibody Biolegend Cat# 400120 RRID: AB_2888687 APC anti-mouse IgG2a Antibody Biolegend Cat# 407110 RRID: AB_2561754 SMAD2/3(D7G7) XP Rabbit mAb Cell Signaling Technology Cat# 8685 RRID: 10891619 Phospho-SMAD2(Ser465/467)/SMAD3 (Ser423/425) (D27F4) Rabbit mAb Cell Signaling Technology Cat# 8828 RRID: 2631089 DRP1 (D6C7) Rabbit mAb Cell Signaling Technology Cat# 8570 RRID: AB_10950498 (Continued on next page) e2 Cell Reports Medicine 6, 102020, March 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Phospho-DRP1 (Ser616) (D9A1) Rabbit mAb Cell Signaling Technology Cat# 4494 RRID: AB_11178659 OPA1 (D7C1A) Rabbit mAb Cell Signaling Technology Cat# 67589 RRID: AB_2799728 MFF (E5W4M) XP Rabbit mAb Cell Signaling Technology Cat# 84580 RRID: AB_2799819 SMAD4 (D3R4N) XP Rabbit mAb Cell Signaling Technology Cat# 46535 RRID: AB_2736998 SMAD4 Polyclonal antibody Proteintech Cat# 10231-1-AP RRID: AB_2193323 a-Smooth Muscle Actin (D4K9N) XP Rabbit mAb Cell Signaling Technology Cat# 19245 RRID: AB_2734735 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat# 9664 RRID: 10828837 CD8a (C8/144B) Mouse mAb Cell Signaling Technology Cat# 70306 RRID: AB_2799781 Anti-CD4 antibody Abcam Cat# ab133616 RRID: AB_2750883 Goat Anti-Rabbit IgG H&L (Alexa Fluor 568) Abcam Cat# ab175471 RRID: AB_2576207 Goat Anti-Mouse IgG H&L (Alexa Fluor 647) Abcam Cat# ab150115 RRID: AB_2687948 Biological samples Patient-derived xenografts (PDX) Jiang. et al.,26 Qin. et al.46 N/A Heathy PBMCs Guangzhou Tianhe Noah Biological Engineering Co., LTD NA Chemicals, peptides, and recombinant proteins TGF beta 1 Protein, Human, Rhesus, Cynomolgus, Canine, Recombinant SinoBiological CAS number: 10804-HNAC TMRM MedChemExpress Cat# HY-D0984 MitoTracker Green Yeasen Cat# 40742ES50 MitoTracker Deep Red Yeasen Cat# 40743ES50 GenCRISPRTM Cas9 v1.2 GenScript Cat# Z03702-1 Seahorse XF Cell Mito Stress Test Kit Agilent Cat# 103010-100 Critical commercial assays Human Granzyme B Precoated ELISA Kit DAKEWE Cat# 1118503 Human IFN-g Precoated ELISA Kit DAKEWE Cat# 1110003 Human IL-2 Precoated ELISA Kit DAKEWE Cat# 1110203 Human TGFb1 Precoated ELISA Kit DAKEWE Cat# 1117102 Human PRF1 Precoated ELISA Kit Bioswamp Cat# HM10300 MACS Pan T cell Isolation Kit Miltenyi Biotec Cat# 130-096-535 MACS GMP T cell TransAct Miltenyi Biotec Cat# 170-076-156 Deposited data Original data of the bulk RNAseq This paper GSA-human: HRA001397 Original western blot images This paper https://doi.org/10.17632/n7htzcxmw4.1 Links: https://data.mendeley.com/drafts/ n7htzcxmw4/1 Experimental models: Cell lines Huh7 Procell Cat# CL-0120 HepG2 Procell Cat# CL-0103 (Continued on next page) Cell Reports Medicine 6, 102020, March 18, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER SK-Hep-1 Procell Cat# CL-0212 AsPc-1 Procell Cat# CL-0027 Hela Procell Cat# CL-0292 Jukrat Procell Cat# CL-0315 Experimental models: Organisms/strains Mouse: NSI, NOD-SCID; IL2rg / Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China N/A Oligonucleotides GZMB target gRNA: 50-TGTCTGCCCTGGCTTCACCT-30 GenScript Cat# C080C988G0 IFNG target gRNA: 50-AAAGAGTGTGGAGACCATCA -30 GenScript Cat# C5095GJ130 ctrl target gRNA: 50-CCGGGTCTTCGAGAAGACCT-3-30 GenScript Cat# C2639HE050 Recombinant DNA Anti-TGFb scFv-CD28 CD3z-2A-eGFP This paper N/A Anti-TGFb scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-CD19 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-GPC3 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-MSLN scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A DnTGFbRII-2A-eGFP This paper N/A Anti-TGFb scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Anti-CD19 scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Software and algorithms FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/ downloads Prism 9.0 GraphPad https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.en.softonic.com BioRender BioRender https://www.biorender.com/ BGI Dr. Tom BGI https://biosys.bgi.com/ iDEP iDEP http://bioinformatics.sdstate.edu/idep/
Article Title: Enhanced differentiation of neural progenitor cells in Alzheimer's disease into vulnerable immature neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-SOX2 antibody Abcam Cat# ab97959; RRID:AB_2341193 Anti-Doublecortin (DCX) antibody Abcam Cat# ab18723; RRID:AB_732011 Neuronal Class III beta-Tubulin (TUJ1) Monoclonal Antibody, Purified BioLegend Cat# 801201; RRID:AB_2313773 GAPDH (6C5) Santa Cruz Biotechnology Cat# sc-32233; RRID:AB_627679 Anti-Nestin, human, clone 10C2 Millipore Cat# MAB5326; RRID:AB_2251134 Human Nestin Phycoerythrin (PE)-conjugated Antibody R&D Systems Cat# IC1259P; RRID:AB_2151147 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat# 9664; RRID:AB_2070042 Anti-phospho-Histone H2A.X (Ser139) Antibody, clone JBW301 Millipore Cat# 05-636; RRID:AB_309864 Chemicals, peptides, and recombinant proteins hESC-qualified matrigel Corning Cat# 356277 mTeSR1 StemCell Technologies Cat# 85850 DMEM/F-12, GlutaMAXTM supplement Gibco Cat# 10565018 NeurobasalTM Medium Gibco Cat# 21103049 MEM Non-essential Amino Acid Solution (100×) Merck Cat# M7145 GlutaMAXTM Supplement Gibco Cat# 35050061 Insulin solution human Sigma-Aldrich Cat# I9278 2-Mercaptoethanol Sigma-Aldrich Cat# M3148 Penicillin-Streptomycin (10,000 U/mL) Gibco Cat# 15140122 B-27TM supplement (50X), serum free Gibco Cat# 17504044 N-2 Supplement (100X) Gibco Cat# 17502001 Dorsomorphin dihydrochloride Tocris Cat# 3093 SB 431542 Tocris Cat# 1614 Recombinant Human FGF-basic (154 a.a.) PeproTech Cat# 100-18B ACCUTASETM StemCell Technologies Cat# 07922 Recombinant Human/Murine/Rat BDNF PeproTech Cat# 450-02 Recombinant Human GDNF PeproTech Cat# 450-10 Glasgow’s MEM (GMEM) Gibco Cat# 11710035 KnockOutTM Serum Replacement Gibco Cat# 10828010 Sodium Pyruvate (100 mM) Gibco Cat# 11360070 endo-IWR 1 Tocris Cat# 3532 Chemically Defined Lipid Concentrate Gibco Cat# 11905031 DPBS Biowest Cat# L0615-500 Tris Duchefa Biochemie Cat# T1501 NaCl Sigma-Aldrich Cat# 9888 NP-40 Sigma-Aldrich Cat# I8896 Sodium deoxycholate Sigma-Aldrich Cat# 264103 SDS Sigma-Aldrich Cat# 62862 TritonTM X-100 Sigma-Aldrich Cat# T9284 BSA assay kit Bio-Rad Cat# 5000006 Tween® 20, Molecular Biology Grade Promega Cat# H5151 Fisher Healthcare Tissue-PlusTM O.C.T. .. Compound Thermo Fisher Scientific Cat# 23-730-571 Skim Milk Powder MB cell Cat# MB-S1667 (Continued on next page) e1 iScience 28, 112446, May 16, 2025
Article Title: Unified modeling of 3D molecular generation via atomic interactions with PocketXMol.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Caspase-9 (C9) Mouse mAb Cell Signaling Technology Cat# 9508; RRID: AB_2068620 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat# 9664; RRID: AB_2070042 β-Actin (13E5) Rabbit mAb Cell Signaling Technology Cat# 4970; RRID: AB_2223172 Caspase-3 Antibody Cell Signaling Technology Cat# 9662; RRID: AB_331439 PARP Antibody Cell Signaling Technology Cat# 9542; RRID: AB_2160739 Alexa Fluor® 594 Anti-PD-L1 antibody (28-8) Abcam Cat # ab213360 Bacterial and virus strains BL21-CodonPlus (DE3)-RILP Competent Cells Agilent Technologies Cat# 230280 Chemicals, peptides, and recombinant proteins ABT-737 Selleck Cat# S1002 Q-VD-Oph Selleck Cat# S7311 Emricasan Selleck Cat# S7775 Recombinant Caspase 3 , Human MedChemExpress Cat# HY-P701341 84663 WuXi AppTec N/A D12 WuXi AppTec N/A D13 WuXi AppTec N/A D18 WuXi AppTec N/A D19 WuXi AppTec N/A Recombinant Human PD-L1 Protein Sino Biological, Inc. Cat#10084-H08H Recombinant Human PD-1 Protein Sino Biological, Inc. Cat#10377-H08H indocyanine green (ICG) RuixiBiotech Co., Ltd. R-H-3102 Peptide GenScript https://www.genscript.com/peptide- services.html?=home Critical commercial assays Caspase 3/7 Activity Assay Kit(Colorimetric Method) Elabscience Cat# E-CK-A383 Ac-DEVD-pNA Elabscience Cat# E-CK-A383 Deposited data Processed dataset for training and evaluation This study Zenodo: https://doi.org/10.5281/zenodo. .. 17801271 PDBBind Liu et al.15 http://pdbbind.org.cn Binding MOAD Benson et al.16 https://pubmed.ncbi.nlm.nih.gov/ 18055497/ CrossDocked2020 Francoeur et al.17 https://github.com/gnina/models/tree/ master/data/CrossDocked2020 PepBDB Wen et al.18 http://huanglab.phys.hust.edu.cn/pepbdb/ AlphaFold DB Varadi et al.1 https://alphafold.ebi.ac.uk/ ChEMBL Gaulton et al.19 https://www.ebi.ac.uk/chembl/ ZINC20 Irwin et al.20 https://zinc20.docking.org/ GEOM dataset Axelrod et al.21 https://github.com/learningmatter-mit/ geom CREMP Grambow et al.22 https://zenodo.org/records/8010582 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–19.e1–e17, April 2, 2026 Please cite this article in press as: Peng et al., Unified modeling of 3D molecular generation via atomic interactions with PocketXMol, Cell (2026), https://doi.org/10.1016/j.cell.2026.01.003 Article
Article Title: Single-cell delineation of the microbiota-gut-brain axis: Probiotic intervention in Chd8 haploinsufficient mice.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CHD8 Abcam Cat#ab114126; RRID:AB_10858797 HRP-conjugated anti-GAPDH Easybio Cat#BE0034 Goat Anti-Rabbit IgG (H&L)-HRP Conjugated Easybio Cat#BE0101-100 KLF4 Antibody Pierce Cat#PA1095; RRID:AB_2539864 Ezrin Antibody (3C12) Pierce Cat#MA513862; RRID:AB_10979020 Donkey anti-Rabbit IgG (H + L) Invitrogen Cat#A31572; RRID:AB_162553 CD3 Monoclonal Antibody (17A2) eBioscience Cat#11-0032-82; RRID:AB_2572431 PE anti-mouse/human CD45R/B220 Antibody biolegend Cat#103028 CD45 Monoclonal Antibody (30-F11) eBioscience Cat#17-0451-82; RRID:AB_469392 Goat anti-Rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen Cat#A-11012; RRID:AB_2534079 Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A-11001; RRID:AB_2534069 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat9664S; RRID:AB_2070042 Bacterial and virus strains Lactobacillus murinus Cultured anaerobically in Gifu Anaerobic Broth (GAM Broth) N/A Biological samples C57BL/6JGpt mice GemPharmatech N/A Chemicals, peptides, and recombinant proteins Gifu Anaerobic Broth (GAM Broth) Hopebio Cat#HB8518 PBS HyClone Cat#SH30256.01 Papain sigmaaldrich Cat#P3125-100MG DNase I coolaber Cat#CD4871 Collagenase I sigmaaldrich Cat#C0130-100MG Collagenase II sigmaaldrich Cat#C6885-100MG Collagenase IV sigmaaldrich Cat#C5138-100MG RIPA Lysis Buffer Beyotime Cat#P0013B PMSF Beyotime Cat#ST506 Protease Inhibitor Cocktail Beyotime Cat#P1010 SDS-PAGE Buffer Beyotime Cat#P0015 RPMI Medium 1640 GIBCO Cat#11875-093 MACS Tissue Storage Solution miltenyi Cat#130-100-008 Debris Removal Solution miltenyi Cat#130-107-677 Fluoromount-G SouthernBiotech Cat#0100-01 DAPI Fluoromount-G SouthernBiotech Cat#0100-20 TRIzolTM Reagent Invitrogen Cat#15596018 acridine orange Invitrogen Cat#A3568 propidium iodide invitrogen Cat#P3566 (Continued on next page) Cell Genomics 5, 100768, February 12, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat#A5670701 Bovine Serum Albumin (BSA) sigmaaldrich Cat#A1933-25G dithiothreitol (DTT) solarbio Cat# D8220 EDTA-Na2 solarbio Cat# E8030 Neutral balsam solarbio Cat#G8590 Water suitable for HPLC sigmaaldrich Cat#270733-2.5L Methanol suitable for UHPLC sigmaaldrich Cat#1037261002 Paraformaldehyde, 4% solarbio Cat#P1110 optimal cutting temperature (O.C.T) sakuraus Cat#4853 DAPI beyotime Cat#C1002 enhanced chemiluminescence (ECL) substrate Easybio Cat#BE6706 Critical commercial assays Chromium Single Cell 30 Kit v2 10x Genomics Cat#CG00052 Adult Brain Dissociation Kit Miltenyi Biotec Cat#130-107-677 Modified Hematoxylin-Eosin(H&E) Stain Kit solarbio Cat#G1121 Deposited data scRNA-seq data This paper https://ngdc.cncb.ac.cn/search/ specific?db=biosample&q=PR PRJCA034312 Experimental models: Organisms/strains Chd8 mutant mice Nanjing Biomedical Research Institute of Nanjing University (NBRI) N/A Chd8 intestinal conditional knockout mice GemPharmatech N/A Cre-positive: C57BL/6JGpt-H11-Vil1-iCre GemPharmatech Cat#T004714 Chd8loxP: C57BL/6JGpt-Chd8em1Cflox/Gpt GemPharmatech Cat#T009485 Oligonucleotides Primers for genotyping, see Table S1 This paper N/A Software and algorithms Cell Ranger v3.1.0 10x Genomics https://support.10xgenomics.com/ single-cell-gene-expression/ software/downloads/latest scanpy v1.6.0 Wof et al.62 https://scanpy.readthedocs.io SCENIC v0.10.3 Van et al.64 https://github.com/aertslab/SCENIC MAST v1.14.0 Finak et al.65 https://rglab.github.io/MAST/ scrublet v0.2.2 Wolock et al.63 https://github.com/swolock/scrublet Scran v1.16.0 Lun et al.66 https://bioconductor.org/packages/ release/bioc/html/scran.html harmonypy v0.0.5 Korsunsky et al.67 https://github.com/immunogenomics/harmony scVelo v0.2.2 Bergen et al.38 https://scvelo.readthedocs.io/en/stable/ scCODA Buttner et al.68 https://sccoda.readthedocs.io/en/ latest/getting_started.html Augur Skinnider et al.25 https://github.com/neurorestore/Augur Cellchat v0.5.0 Jin et al.69 https://github.com/sqjin/CellChat GSEApy v0.10.1 Mootha et al.70 https://gseapy.readthedocs.io/ en/latest/index.html MSigDB Subramanian et al.28 https://www.gsea-msigdb.org/gsea/msigdb g:Profiler Raudvere et al.71 https://biit.cs.ut.ee/gprofiler/ PAGA Wolf et al.72 https://github.com/theislab/paga e2 Cell Genomics 5, 100768, February 12, 2025 OPEN ACCESS OPEN ACCESS
Article Title: PI5P4Kα promotes glucose and iron acquisition to support metabolic fitness in pancreatic cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PIP4K2A (D83C1) Rabbit mAb Cell signaling Technology Cat# 5527; RRID:AB_2722636 PARP (46D11) Rabbit mAb Cell signaling Technology Cat# 9532; RRID:AB_659884 p62/SQSTM1 (2C11) mouse mAb Abnova Cat# H00008878-M01; RRID:AB_437085 LC3A/B (D3U4C) Rabbit mAb Cell signaling Technology Cat# 12741; RRID:AB_2617131 Tubulin (TUBA1) mouse mAb Millipore Sigma Cat# T6199; RRID:AB_477583 Phospho-histone H3 (Ser10) Rabbit mAb Cell signaling Technology Cat# 9701; RRID:AB_331535 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell signaling Technology Cat# 9664; RRID:AB_2070042 IRDye® 680LT Goat anti-mouse IgG secondary Ab LICORbio Cat# 926–68020; RRID:AB_2687826 IRDye® 800CW Goat anti-Rabbit IgG secondary Ab LICORbio Cat# 926–32211; RRID:AB_621843 Glut1 (E4S6I) Rabbit mAb Cell signaling Technology Cat# 73015; RRID:AB_3064908 ASNS Polyclonal antibody Proteintech Cat#14681-1-AP; RRID: AB_2060119 CD71 antibody, anti-human, PE, REAfinityTM, REA902 | AC102 Miltenyi Biotec Cat#130-115-029; RRID:AB_2726859 Bacterial and virus strains Lentivirus Produced using pLKO.1-puro shRNA system in HEK293T cells N/A DH5α E. coli Zymo research Cat# T3007 Biological samples Mouse pancreatic tumors Sanford Burnham Prebys Medical Discovery Institute vivarium N/A Human PDAC tissue samples University of Bern N/A Chemicals, peptides, and recombinant proteins Polybrene Santa Cruz Biotechnology Cat# SC134220 Formaldehyde 37% RICCA chemical company Cat# RSOF0010 Crystal violet Millipore Sigma Cat# C0775 Emricasan MedKoo Biosciences Cat# 510230 Tetramethylrhodamine, Ethyl Ester, Perchlorate (TMRE) ThermoFisher Scientific Cat# T669 Transferrin (human) CF® 594 Conjugate Biotium Cat# #00084 DAPI (4′,6-Diamidino-2Phenylindole, Dilactate) BioLegend Cat# 422801 Hoechst 33342 MP Biomedicals Cat# 0219030525 Doxycycline hyclate Millipore Sigma Cat# D9891 Sodium L-lactate Millipore Sigma Cat# 71718 Sodium pyruvate ThermoFisher Scientific Cat# 11360070 Dimethyl 2-oxoglutarate Millipore Sigma Cat# 349631 Dimethyl DL-Glutamate (hydrochloride) Cayman chemical Cat# 18602 Ammonium iron(III) citrate (FAC) Millipore Sigma Cat# F5879 Ferrostatin-1 Fisher Scientific Cat# 50-225-9214 Sodium citrate VWR Cat# 0101 Bafilomycin A1 Selleckchem Cat# S1413 DMEM with L-Glutamine and 4.5g/L glucose; without sodium pyruvate Corning Cat# 10017CV (Continued on next page) 16 Cell Reports 44, 116199, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mouse: Nude (Foxn1nu) The Jackson Laboratory Cat# 002019; RRID:IMSR_JAX:002019 Oligonucleotides PIP4K2A-F Custom DNA Oligos CGTAGCGCAGAAAGTGAAGC PIP4K2A-R Custom DNA Oligos GGCTCGGCATGTTTTCTTTGT Recombinant DNA pLKO.1 puro Addgene Cat# 8453 psPAX2 Addgene Cat# 12260 pVSV-G Addgene Cat# 138479 pCL-Ampho Novus biologicals Cat# NBP2-29541 pLKO.1 shSCR Addgene Cat# 17920 pLKO.1-puro-sh α1 Lab-generated sh α#1-TRCN0000220609; 5′- CCTCGGACAGACATGAACATT-3′ pLKO.1-puro-sh α2 Lab-generated sh α#2 -TRCN0000195145; 5′- CCAGCATCGTTCTAGCTATTT-3′ Tet-pLKO-puro Addgene Cat# 21915 Tet-pLKO-puro-sh α1 Lab-generated sh α#1-TRCN0000220609; 5′- CCTCGGACAGACATGAACATT-3′ Tet-pLKO-puro-sh α2 Lab-generated sh α#2 -TRCN0000195145; 5′- CCAGCATCGTTCTAGCTATTT-3′ mCherry-eGFP-LC3B NovoPro Cat# V012182 Software and algorithms GraphPad Prism version 10.0.0 GraphPad software RRID:SCR_002798; https://www.graphpad.com Fiji (ImageJ) NIH RRID:SCR_002285; https://fiji.sc BioTek Gen5 Agilent Technologies RRID:SCR_017317; https://www.agilent.com/en/ support/biotek-software-releases FACSDiVa v8.0.2.
Protease Inhibitor:Article Title: Mitochondrial Ca 2+ controls pancreatic cancer growth and metastasis by regulating epithelial cell plasticity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies beta Tubulin Monoclonal Antibody Invitrogen 32–2600; RRID: AB_2533072 MCU (D2Z3B) Rabbit mAb Cell Signaling 14997; RRID: AB_2721812 Vimentin (D21H3) XP® Rabbit mAb Cell Signaling 5741; RRID: AB_10695459 N-Cadherin (D4R1H) XP® Rabbit mAb Cell Signaling 13116; RRID: AB_2687616 E-Cadherin (24E10) Rabbit mAb Cell Signaling 3195; RRID: AB_2291471 Snail (C15D3) Rabbit mAb Cell Signaling 3879; RRID: AB_2255011 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling 7074; RRID: AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling 7076; RRID: AB_330924 HIF-1α (D1S7W) XP® Rabbit mAb Cell Signaling 36169; RRID: AB_2799095 Nrf2 (D1Z9C) XP® Rabbit mAb Cell Signaling 12721: RRID: AB_2715528 Anti-MCU antibody produced in rabbit Sigma Aldrich HPA016480; RRID: AB_2071893 Monoclonal Anti-mouse E-cadherin (Clone ECCD-2) Takara M108; RRID: AB_2895157 Rabbit anti-Ki67 antibody SP6 Abcam ab16667; RRID: AB_302459 Caspase-3 (D3R6Y) Rabbit mAb Cell Signaling 14220: RRID: AB_2798429 Cleaved Caspase 3 (Asp175) (5A1E) Rabbit mAb Cell Signaling 9664: RRID: AB_2070042 Anti-Green Fluorescent Protein Antibody (Goat Polyclonal) Abcam ab6673; RRID: AB_305643 Tgf beta-1,2,3 Monoclonal Antibody (1D11), Unconjugated, Species Reactivity: Human, Host: Mouse/IgG1 Thermo Fisher Scientific MA5-23795; RRID: AB_2609812 Chemicals, peptides, and recombinant proteins Triton X-100 Sigma T9284 TGF beta Millipore Sigma SRP3171 Basic Fibroblast Growth Factor Sigma Aldrich F0291 B-27 supplement Life Technologies 17504–044 Epidermal Growth Factor Sigma Aldrich E5036 Insulin Life Technologies A11429IJ Bovine Serum Albumin Sigma Aldrich A9576 Aggrewell Antiadherence solution Stem Cell Technologies 07010 cOmplete Mini protease inhibitor cocktail, EDTA free Roche 11836170001 NuPAGE 4–12% bis/tris mini protein gels Invitrogen NP0321-0323 Immobilon P PVDF membrane Millipore IPVH00010 Precision Plus Dual Color Standard Biorad 161–0374 NuPAGETM MES SDS Running Buffer (20X) Invitrogen NP0002 Puromycin dihydrochloride, 10 mg/mL Life Technologies A11138-03 Geneticin Invitrogen 10131035 Lipofectamine 3000 Thermo Fisher Scientific L3000001 Fluoromount-GTM Mounting Medium with DAPI Invitrogen 00-4959-52 (Continued on next page) Cell Reports 44, 115627, May 27, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Mouse Cytokine/Chemokine 32-Plex Discovery Assay® Array Eve Technologies MD32 Mouse TGF beta 1 ELISA kit Abcam ab119557 RNeasy Mini kit Qiagen 74104 ECMatrix Cell Invasion Assay 8 uM Millipore Sigma ECM550 Corning® 6.5 mm Transwell® with 8.0 μm Pore Polyester Membrane Insert, Sterile Corning 3464 Deposited data Mitochondrial Ca2+ controls pancreatic cancer growth and metastasis by regulating epithelial cell plasticity Weissenrieder JS, Foskett JK GEO: GSE287625 Expression Analysis of Normal and Neoplastic Mouse Pancreatic Ductal Organoids Tuveson DA, Baker LA GEO: GSE63348 Analysis of donor pancreata defines the transcriptomic signature and microenvironment of early neoplastic lesions (reanalyzed from dbGap phs002071 Pasca di Magliano M, Carpenter ES, Elhossiny AM GEO: GSE229413 Experimental models: Cell lines Panc-1 ATCC CRL-1469 HPDE Kerafast H6c7 MiaPaCa-2 ATCC CRL-1420 2838.c3 murine KPCY line Stanger lab Stanger lab 1151 murine KPCY-McuCre-KO This paper This paper 2838.c3 murine KPCY-McuWT pLentiCRISPR-EV clones 15&22 This paper This paper 2838.c3 murine KPCY-McuCRISPR-KO clones 17 and 42 This paper This paper 1151 murine KPCY-McuCre-KO empty vector clones 1 & 3 This paper This paper 1151 murine KPCY-Mcurescue clones 2,3,4,5,6, & 9 This paper This paper 2838.c3 KPCY-McuWT EV cl 15 + pCDH-EV This paper This paper 2838.c3 KPCY-McuWT EV cl 15 + pCDHSnail This paper This paper Experimental models: Organisms/strains C57BL/6J Mice Jackson Laboratories 000664 Pdx1-Cre;KrasG12D/+;Tp53R172H/+;R26LslYfp/Lsl-Yfp;Mcufl/fl mice in C57BL/6J background This paper This paper Recombinant DNA pCMV6-A-MCU-V5-His-puro Generated in lab DOI: pnas.2005976117 pCMV6-A-EV-puro Origene PS100025 pCDH-Snail-blasti N/A pCDH-EV-blasti pLentiCRISPR V2-sgMCU Mohamed Trebak lab N/A pLentiCRISPR V2-EV Addgene 52961 Software and algorithms Prism GraphPad N/A
Article Title: Single-cell delineation of the microbiota-gut-brain axis: Probiotic intervention in Chd8 haploinsufficient mice.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CHD8 Abcam Cat#ab114126; RRID:AB_10858797 HRP-conjugated anti-GAPDH Easybio Cat#BE0034 Goat Anti-Rabbit IgG (H&L)-HRP Conjugated Easybio Cat#BE0101-100 KLF4 Antibody Pierce Cat#PA1095; RRID:AB_2539864 Ezrin Antibody (3C12) Pierce Cat#MA513862; RRID:AB_10979020 Donkey anti-Rabbit IgG (H + L) Invitrogen Cat#A31572; RRID:AB_162553 CD3 Monoclonal Antibody (17A2) eBioscience Cat#11-0032-82; RRID:AB_2572431 PE anti-mouse/human CD45R/B220 Antibody biolegend Cat#103028 CD45 Monoclonal Antibody (30-F11) eBioscience Cat#17-0451-82; RRID:AB_469392 Goat anti-Rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen Cat#A-11012; RRID:AB_2534079 Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A-11001; RRID:AB_2534069 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat9664S; RRID:AB_2070042 Bacterial and virus strains Lactobacillus murinus Cultured anaerobically in Gifu Anaerobic Broth (GAM Broth) N/A Biological samples C57BL/6JGpt mice GemPharmatech N/A Chemicals, peptides, and recombinant proteins Gifu Anaerobic Broth (GAM Broth) Hopebio Cat#HB8518 PBS HyClone Cat#SH30256.01 Papain sigmaaldrich Cat#P3125-100MG DNase I coolaber Cat#CD4871 Collagenase I sigmaaldrich Cat#C0130-100MG Collagenase II sigmaaldrich Cat#C6885-100MG Collagenase IV sigmaaldrich Cat#C5138-100MG RIPA Lysis Buffer Beyotime Cat#P0013B PMSF Beyotime Cat#ST506 Protease Inhibitor Cocktail Beyotime Cat#P1010 SDS-PAGE Buffer Beyotime Cat#P0015 RPMI Medium 1640 GIBCO Cat#11875-093 MACS Tissue Storage Solution miltenyi Cat#130-100-008 Debris Removal Solution miltenyi Cat#130-107-677 Fluoromount-G SouthernBiotech Cat#0100-01 DAPI Fluoromount-G SouthernBiotech Cat#0100-20 TRIzolTM Reagent Invitrogen Cat#15596018 acridine orange Invitrogen Cat#A3568 propidium iodide invitrogen Cat#P3566 (Continued on next page) Cell Genomics 5, 100768, February 12, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat#A5670701 Bovine Serum Albumin (BSA) sigmaaldrich Cat#A1933-25G dithiothreitol (DTT) solarbio Cat# D8220 EDTA-Na2 solarbio Cat# E8030 Neutral balsam solarbio Cat#G8590 Water suitable for HPLC sigmaaldrich Cat#270733-2.5L Methanol suitable for UHPLC sigmaaldrich Cat#1037261002 Paraformaldehyde, 4% solarbio Cat#P1110 optimal cutting temperature (O.C.T) sakuraus Cat#4853 DAPI beyotime Cat#C1002 enhanced chemiluminescence (ECL) substrate Easybio Cat#BE6706 Critical commercial assays Chromium Single Cell 30 Kit v2 10x Genomics Cat#CG00052 Adult Brain Dissociation Kit Miltenyi Biotec Cat#130-107-677 Modified Hematoxylin-Eosin(H&E) Stain Kit solarbio Cat#G1121 Deposited data scRNA-seq data This paper https://ngdc.cncb.ac.cn/search/ specific?db=biosample&q=PR PRJCA034312 Experimental models: Organisms/strains Chd8 mutant mice Nanjing Biomedical Research Institute of Nanjing University (NBRI) N/A Chd8 intestinal conditional knockout mice GemPharmatech N/A Cre-positive: C57BL/6JGpt-H11-Vil1-iCre GemPharmatech Cat#T004714 Chd8loxP: C57BL/6JGpt-Chd8em1Cflox/Gpt GemPharmatech Cat#T009485 Oligonucleotides Primers for genotyping, see Table S1 This paper N/A Software and algorithms Cell Ranger v3.1.0 10x Genomics https://support.10xgenomics.com/ single-cell-gene-expression/ software/downloads/latest scanpy v1.6.0 Wof et al.62 https://scanpy.readthedocs.io SCENIC v0.10.3 Van et al.64 https://github.com/aertslab/SCENIC MAST v1.14.0 Finak et al.65 https://rglab.github.io/MAST/ scrublet v0.2.2 Wolock et al.63 https://github.com/swolock/scrublet Scran v1.16.0 Lun et al.66 https://bioconductor.org/packages/ release/bioc/html/scran.html harmonypy v0.0.5 Korsunsky et al.67 https://github.com/immunogenomics/harmony scVelo v0.2.2 Bergen et al.38 https://scvelo.readthedocs.io/en/stable/ scCODA Buttner et al.68 https://sccoda.readthedocs.io/en/ latest/getting_started.html Augur Skinnider et al.25 https://github.com/neurorestore/Augur Cellchat v0.5.0 Jin et al.69 https://github.com/sqjin/CellChat GSEApy v0.10.1 Mootha et al.70 https://gseapy.readthedocs.io/ en/latest/index.html MSigDB Subramanian et al.28 https://www.gsea-msigdb.org/gsea/msigdb g:Profiler Raudvere et al.71 https://biit.cs.ut.ee/gprofiler/ PAGA Wolf et al.72 https://github.com/theislab/paga e2 Cell Genomics 5, 100768, February 12, 2025 OPEN ACCESS OPEN ACCESS
Membrane:Article Title: Mitochondrial Ca 2+ controls pancreatic cancer growth and metastasis by regulating epithelial cell plasticity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies beta Tubulin Monoclonal Antibody Invitrogen 32–2600; RRID: AB_2533072 MCU (D2Z3B) Rabbit mAb Cell Signaling 14997; RRID: AB_2721812 Vimentin (D21H3) XP® Rabbit mAb Cell Signaling 5741; RRID: AB_10695459 N-Cadherin (D4R1H) XP® Rabbit mAb Cell Signaling 13116; RRID: AB_2687616 E-Cadherin (24E10) Rabbit mAb Cell Signaling 3195; RRID: AB_2291471 Snail (C15D3) Rabbit mAb Cell Signaling 3879; RRID: AB_2255011 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling 7074; RRID: AB_2099233 Anti-mouse IgG, HRP-linked Antibody Cell Signaling 7076; RRID: AB_330924 HIF-1α (D1S7W) XP® Rabbit mAb Cell Signaling 36169; RRID: AB_2799095 Nrf2 (D1Z9C) XP® Rabbit mAb Cell Signaling 12721: RRID: AB_2715528 Anti-MCU antibody produced in rabbit Sigma Aldrich HPA016480; RRID: AB_2071893 Monoclonal Anti-mouse E-cadherin (Clone ECCD-2) Takara M108; RRID: AB_2895157 Rabbit anti-Ki67 antibody SP6 Abcam ab16667; RRID: AB_302459 Caspase-3 (D3R6Y) Rabbit mAb Cell Signaling 14220: RRID: AB_2798429 Cleaved Caspase 3 (Asp175) (5A1E) Rabbit mAb Cell Signaling 9664: RRID: AB_2070042 Anti-Green Fluorescent Protein Antibody (Goat Polyclonal) Abcam ab6673; RRID: AB_305643 Tgf beta-1,2,3 Monoclonal Antibody (1D11), Unconjugated, Species Reactivity: Human, Host: Mouse/IgG1 Thermo Fisher Scientific MA5-23795; RRID: AB_2609812 Chemicals, peptides, and recombinant proteins Triton X-100 Sigma T9284 TGF beta Millipore Sigma SRP3171 Basic Fibroblast Growth Factor Sigma Aldrich F0291 B-27 supplement Life Technologies 17504–044 Epidermal Growth Factor Sigma Aldrich E5036 Insulin Life Technologies A11429IJ Bovine Serum Albumin Sigma Aldrich A9576 Aggrewell Antiadherence solution Stem Cell Technologies 07010 cOmplete Mini protease inhibitor cocktail, EDTA free Roche 11836170001 NuPAGE 4–12% bis/tris mini protein gels Invitrogen NP0321-0323 Immobilon P PVDF membrane Millipore IPVH00010 Precision Plus Dual Color Standard Biorad 161–0374 NuPAGETM MES SDS Running Buffer (20X) Invitrogen NP0002 Puromycin dihydrochloride, 10 mg/mL Life Technologies A11138-03 Geneticin Invitrogen 10131035 Lipofectamine 3000 Thermo Fisher Scientific L3000001 Fluoromount-GTM Mounting Medium with DAPI Invitrogen 00-4959-52 (Continued on next page) Cell Reports 44, 115627, May 27, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays Mouse Cytokine/Chemokine 32-Plex Discovery Assay® Array Eve Technologies MD32 Mouse TGF beta 1 ELISA kit Abcam ab119557 RNeasy Mini kit Qiagen 74104 ECMatrix Cell Invasion Assay 8 uM Millipore Sigma ECM550 Corning® 6.5 mm Transwell® with 8.0 μm Pore Polyester Membrane Insert, Sterile Corning 3464 Deposited data Mitochondrial Ca2+ controls pancreatic cancer growth and metastasis by regulating epithelial cell plasticity Weissenrieder JS, Foskett JK GEO: GSE287625 Expression Analysis of Normal and Neoplastic Mouse Pancreatic Ductal Organoids Tuveson DA, Baker LA GEO: GSE63348 Analysis of donor pancreata defines the transcriptomic signature and microenvironment of early neoplastic lesions (reanalyzed from dbGap phs002071 Pasca di Magliano M, Carpenter ES, Elhossiny AM GEO: GSE229413 Experimental models: Cell lines Panc-1 ATCC CRL-1469 HPDE Kerafast H6c7 MiaPaCa-2 ATCC CRL-1420 2838.c3 murine KPCY line Stanger lab Stanger lab 1151 murine KPCY-McuCre-KO This paper This paper 2838.c3 murine KPCY-McuWT pLentiCRISPR-EV clones 15&22 This paper This paper 2838.c3 murine KPCY-McuCRISPR-KO clones 17 and 42 This paper This paper 1151 murine KPCY-McuCre-KO empty vector clones 1 & 3 This paper This paper 1151 murine KPCY-Mcurescue clones 2,3,4,5,6, & 9 This paper This paper 2838.c3 KPCY-McuWT EV cl 15 + pCDH-EV This paper This paper 2838.c3 KPCY-McuWT EV cl 15 + pCDHSnail This paper This paper Experimental models: Organisms/strains C57BL/6J Mice Jackson Laboratories 000664 Pdx1-Cre;KrasG12D/+;Tp53R172H/+;R26LslYfp/Lsl-Yfp;Mcufl/fl mice in C57BL/6J background This paper This paper Recombinant DNA pCMV6-A-MCU-V5-His-puro Generated in lab DOI: pnas.2005976117 pCMV6-A-EV-puro Origene PS100025 pCDH-Snail-blasti N/A pCDH-EV-blasti pLentiCRISPR V2-sgMCU Mohamed Trebak lab N/A pLentiCRISPR V2-EV Addgene 52961 Software and algorithms Prism GraphPad N/A
Enzyme-linked Immunosorbent Assay:Article Title: CD4 + anti-TGF-β CAR T cells and CD8 + conventional CAR T cells exhibit synergistic antitumor effects.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human CD25 Antibody R&D systems Cat# AF-223-NA RRID: AB_354408 Purified anti-human CXCR3 (Maxpar Ready) Antibody Fluidigm Cat# 3163004B Purified anti-human CCR6 (Maxpar Ready) Antibody Fluidigm Cat# 3141003A Anti-Human CD45 (HI30)-89Y Fluidigm Cat# 3089003B TIGIT Monoclonal Antibody (MBSA43), Functional Grade, eBioscienceTM Thermo Cat# 16-9500-82 RRID: AB_10718831 FOXP3 Monoclonal Antibody (PCH101), Functional Grade, eBioscienceTM Thermo Cat# 14-4776-82 RRID: AB_467553 APC/Cyanine7 anti-human CD279 (PD-1) Antibody Biolegend Cat# 367416 RRID: AB_2616744 APC anti-human CD279 (PD-1) Antibody Biolegend Cat# 367406 RRID: AB_2566067 PE/Cyanine7 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369208 RRID: AB_2629835 PerCP/Cyanine5.5 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369216 RRID: AB_2910413 APC anti-human CD3 Antibody Biolegend Cat# 300439 RRID: AB_2562045 PE/Cyanine7 anti-human CD3 Antibody Biolegend Cat# 300420 RRID: AB_439781 APC/Cyanine7 anti-human CD4 Antibody Biolegend Cat# 317418 RRID: AB_571947 PE anti-human CD8 Antibody Biolegend Cat# 303804 RRID: AB_2860786 APC anti-human CD25 Antibody Biolegend Cat# 356110 RRID: AB_2561977 PE/Cyanine7 anti-human CD69 Antibody Biolegend Cat# 310912 RRID: AB_314847 APC anti-human CD69 Antibody Biolegend Cat# 310910 RRID: AB_314845 PE anti-human CD69 Antibody Biolegend Cat# 310906 RRID: AB_314841 PE anti-human NKG2D Antibody Biolegend Cat# 320806 RRID: AB_492960 APC anti-human MICA/B Antibody Biolegend Cat# 320908 RRID: AB_493196 Human ULBP-2/5/6 APC-conjugated Antibody R&D systems Cat# FAB1298A RRID: AB_2257142 Human Mesothelin APC-conjugated Antibody R&D systems Cat# FAB32652A RRID: AB_2298058 APC Mouse IgG1, k Isotype Ctrl Antibody Biolegend Cat# 400120 RRID: AB_2888687 APC anti-mouse IgG2a Antibody Biolegend Cat# 407110 RRID: AB_2561754 SMAD2/3(D7G7) XP Rabbit mAb Cell Signaling Technology Cat# 8685 RRID: 10891619 Phospho-SMAD2(Ser465/467)/SMAD3 (Ser423/425) (D27F4) Rabbit mAb Cell Signaling Technology Cat# 8828 RRID: 2631089 DRP1 (D6C7) Rabbit mAb Cell Signaling Technology Cat# 8570 RRID: AB_10950498 (Continued on next page) e2 Cell Reports Medicine 6, 102020, March 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Phospho-DRP1 (Ser616) (D9A1) Rabbit mAb Cell Signaling Technology Cat# 4494 RRID: AB_11178659 OPA1 (D7C1A) Rabbit mAb Cell Signaling Technology Cat# 67589 RRID: AB_2799728 MFF (E5W4M) XP Rabbit mAb Cell Signaling Technology Cat# 84580 RRID: AB_2799819 SMAD4 (D3R4N) XP Rabbit mAb Cell Signaling Technology Cat# 46535 RRID: AB_2736998 SMAD4 Polyclonal antibody Proteintech Cat# 10231-1-AP RRID: AB_2193323 a-Smooth Muscle Actin (D4K9N) XP Rabbit mAb Cell Signaling Technology Cat# 19245 RRID: AB_2734735 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat# 9664 RRID: 10828837 CD8a (C8/144B) Mouse mAb Cell Signaling Technology Cat# 70306 RRID: AB_2799781 Anti-CD4 antibody Abcam Cat# ab133616 RRID: AB_2750883 Goat Anti-Rabbit IgG H&L (Alexa Fluor 568) Abcam Cat# ab175471 RRID: AB_2576207 Goat Anti-Mouse IgG H&L (Alexa Fluor 647) Abcam Cat# ab150115 RRID: AB_2687948 Biological samples Patient-derived xenografts (PDX) Jiang. et al.,26 Qin. et al.46 N/A Heathy PBMCs Guangzhou Tianhe Noah Biological Engineering Co., LTD NA Chemicals, peptides, and recombinant proteins TGF beta 1 Protein, Human, Rhesus, Cynomolgus, Canine, Recombinant SinoBiological CAS number: 10804-HNAC TMRM MedChemExpress Cat# HY-D0984 MitoTracker Green Yeasen Cat# 40742ES50 MitoTracker Deep Red Yeasen Cat# 40743ES50 GenCRISPRTM Cas9 v1.2 GenScript Cat# Z03702-1 Seahorse XF Cell Mito Stress Test Kit Agilent Cat# 103010-100 Critical commercial assays Human Granzyme B Precoated ELISA Kit DAKEWE Cat# 1118503 Human IFN-g Precoated ELISA Kit DAKEWE Cat# 1110003 Human IL-2 Precoated ELISA Kit DAKEWE Cat# 1110203 Human TGFb1 Precoated ELISA Kit DAKEWE Cat# 1117102 Human PRF1 Precoated ELISA Kit Bioswamp Cat# HM10300 MACS Pan T cell Isolation Kit Miltenyi Biotec Cat# 130-096-535 MACS GMP T cell TransAct Miltenyi Biotec Cat# 170-076-156 Deposited data Original data of the bulk RNAseq This paper GSA-human: HRA001397 Original western blot images This paper https://doi.org/10.17632/n7htzcxmw4.1 Links: https://data.mendeley.com/drafts/ n7htzcxmw4/1 Experimental models: Cell lines Huh7 Procell Cat# CL-0120 HepG2 Procell Cat# CL-0103 (Continued on next page) Cell Reports Medicine 6, 102020, March 18, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER SK-Hep-1 Procell Cat# CL-0212 AsPc-1 Procell Cat# CL-0027 Hela Procell Cat# CL-0292 Jukrat Procell Cat# CL-0315 Experimental models: Organisms/strains Mouse: NSI, NOD-SCID; IL2rg / Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China N/A Oligonucleotides GZMB target gRNA: 50-TGTCTGCCCTGGCTTCACCT-30 GenScript Cat# C080C988G0 IFNG target gRNA: 50-AAAGAGTGTGGAGACCATCA -30 GenScript Cat# C5095GJ130 ctrl target gRNA: 50-CCGGGTCTTCGAGAAGACCT-3-30 GenScript Cat# C2639HE050 Recombinant DNA Anti-TGFb scFv-CD28 CD3z-2A-eGFP This paper N/A Anti-TGFb scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-CD19 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-GPC3 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-MSLN scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A DnTGFbRII-2A-eGFP This paper N/A Anti-TGFb scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Anti-CD19 scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Software and algorithms FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/ downloads Prism 9.0 GraphPad https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.en.softonic.com BioRender BioRender https://www.biorender.com/ BGI Dr. Tom BGI https://biosys.bgi.com/ iDEP iDEP http://bioinformatics.sdstate.edu/idep/
Magnetic Cell Separation:Article Title: CD4 + anti-TGF-β CAR T cells and CD8 + conventional CAR T cells exhibit synergistic antitumor effects.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human CD25 Antibody R&D systems Cat# AF-223-NA RRID: AB_354408 Purified anti-human CXCR3 (Maxpar Ready) Antibody Fluidigm Cat# 3163004B Purified anti-human CCR6 (Maxpar Ready) Antibody Fluidigm Cat# 3141003A Anti-Human CD45 (HI30)-89Y Fluidigm Cat# 3089003B TIGIT Monoclonal Antibody (MBSA43), Functional Grade, eBioscienceTM Thermo Cat# 16-9500-82 RRID: AB_10718831 FOXP3 Monoclonal Antibody (PCH101), Functional Grade, eBioscienceTM Thermo Cat# 14-4776-82 RRID: AB_467553 APC/Cyanine7 anti-human CD279 (PD-1) Antibody Biolegend Cat# 367416 RRID: AB_2616744 APC anti-human CD279 (PD-1) Antibody Biolegend Cat# 367406 RRID: AB_2566067 PE/Cyanine7 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369208 RRID: AB_2629835 PerCP/Cyanine5.5 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369216 RRID: AB_2910413 APC anti-human CD3 Antibody Biolegend Cat# 300439 RRID: AB_2562045 PE/Cyanine7 anti-human CD3 Antibody Biolegend Cat# 300420 RRID: AB_439781 APC/Cyanine7 anti-human CD4 Antibody Biolegend Cat# 317418 RRID: AB_571947 PE anti-human CD8 Antibody Biolegend Cat# 303804 RRID: AB_2860786 APC anti-human CD25 Antibody Biolegend Cat# 356110 RRID: AB_2561977 PE/Cyanine7 anti-human CD69 Antibody Biolegend Cat# 310912 RRID: AB_314847 APC anti-human CD69 Antibody Biolegend Cat# 310910 RRID: AB_314845 PE anti-human CD69 Antibody Biolegend Cat# 310906 RRID: AB_314841 PE anti-human NKG2D Antibody Biolegend Cat# 320806 RRID: AB_492960 APC anti-human MICA/B Antibody Biolegend Cat# 320908 RRID: AB_493196 Human ULBP-2/5/6 APC-conjugated Antibody R&D systems Cat# FAB1298A RRID: AB_2257142 Human Mesothelin APC-conjugated Antibody R&D systems Cat# FAB32652A RRID: AB_2298058 APC Mouse IgG1, k Isotype Ctrl Antibody Biolegend Cat# 400120 RRID: AB_2888687 APC anti-mouse IgG2a Antibody Biolegend Cat# 407110 RRID: AB_2561754 SMAD2/3(D7G7) XP Rabbit mAb Cell Signaling Technology Cat# 8685 RRID: 10891619 Phospho-SMAD2(Ser465/467)/SMAD3 (Ser423/425) (D27F4) Rabbit mAb Cell Signaling Technology Cat# 8828 RRID: 2631089 DRP1 (D6C7) Rabbit mAb Cell Signaling Technology Cat# 8570 RRID: AB_10950498 (Continued on next page) e2 Cell Reports Medicine 6, 102020, March 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Phospho-DRP1 (Ser616) (D9A1) Rabbit mAb Cell Signaling Technology Cat# 4494 RRID: AB_11178659 OPA1 (D7C1A) Rabbit mAb Cell Signaling Technology Cat# 67589 RRID: AB_2799728 MFF (E5W4M) XP Rabbit mAb Cell Signaling Technology Cat# 84580 RRID: AB_2799819 SMAD4 (D3R4N) XP Rabbit mAb Cell Signaling Technology Cat# 46535 RRID: AB_2736998 SMAD4 Polyclonal antibody Proteintech Cat# 10231-1-AP RRID: AB_2193323 a-Smooth Muscle Actin (D4K9N) XP Rabbit mAb Cell Signaling Technology Cat# 19245 RRID: AB_2734735 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat# 9664 RRID: 10828837 CD8a (C8/144B) Mouse mAb Cell Signaling Technology Cat# 70306 RRID: AB_2799781 Anti-CD4 antibody Abcam Cat# ab133616 RRID: AB_2750883 Goat Anti-Rabbit IgG H&L (Alexa Fluor 568) Abcam Cat# ab175471 RRID: AB_2576207 Goat Anti-Mouse IgG H&L (Alexa Fluor 647) Abcam Cat# ab150115 RRID: AB_2687948 Biological samples Patient-derived xenografts (PDX) Jiang. et al.,26 Qin. et al.46 N/A Heathy PBMCs Guangzhou Tianhe Noah Biological Engineering Co., LTD NA Chemicals, peptides, and recombinant proteins TGF beta 1 Protein, Human, Rhesus, Cynomolgus, Canine, Recombinant SinoBiological CAS number: 10804-HNAC TMRM MedChemExpress Cat# HY-D0984 MitoTracker Green Yeasen Cat# 40742ES50 MitoTracker Deep Red Yeasen Cat# 40743ES50 GenCRISPRTM Cas9 v1.2 GenScript Cat# Z03702-1 Seahorse XF Cell Mito Stress Test Kit Agilent Cat# 103010-100 Critical commercial assays Human Granzyme B Precoated ELISA Kit DAKEWE Cat# 1118503 Human IFN-g Precoated ELISA Kit DAKEWE Cat# 1110003 Human IL-2 Precoated ELISA Kit DAKEWE Cat# 1110203 Human TGFb1 Precoated ELISA Kit DAKEWE Cat# 1117102 Human PRF1 Precoated ELISA Kit Bioswamp Cat# HM10300 MACS Pan T cell Isolation Kit Miltenyi Biotec Cat# 130-096-535 MACS GMP T cell TransAct Miltenyi Biotec Cat# 170-076-156 Deposited data Original data of the bulk RNAseq This paper GSA-human: HRA001397 Original western blot images This paper https://doi.org/10.17632/n7htzcxmw4.1 Links: https://data.mendeley.com/drafts/ n7htzcxmw4/1 Experimental models: Cell lines Huh7 Procell Cat# CL-0120 HepG2 Procell Cat# CL-0103 (Continued on next page) Cell Reports Medicine 6, 102020, March 18, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER SK-Hep-1 Procell Cat# CL-0212 AsPc-1 Procell Cat# CL-0027 Hela Procell Cat# CL-0292 Jukrat Procell Cat# CL-0315 Experimental models: Organisms/strains Mouse: NSI, NOD-SCID; IL2rg / Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China N/A Oligonucleotides GZMB target gRNA: 50-TGTCTGCCCTGGCTTCACCT-30 GenScript Cat# C080C988G0 IFNG target gRNA: 50-AAAGAGTGTGGAGACCATCA -30 GenScript Cat# C5095GJ130 ctrl target gRNA: 50-CCGGGTCTTCGAGAAGACCT-3-30 GenScript Cat# C2639HE050 Recombinant DNA Anti-TGFb scFv-CD28 CD3z-2A-eGFP This paper N/A Anti-TGFb scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-CD19 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-GPC3 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-MSLN scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A DnTGFbRII-2A-eGFP This paper N/A Anti-TGFb scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Anti-CD19 scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Software and algorithms FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/ downloads Prism 9.0 GraphPad https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.en.softonic.com BioRender BioRender https://www.biorender.com/ BGI Dr. Tom BGI https://biosys.bgi.com/ iDEP iDEP http://bioinformatics.sdstate.edu/idep/
Article Title: Single-cell delineation of the microbiota-gut-brain axis: Probiotic intervention in Chd8 haploinsufficient mice.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CHD8 Abcam Cat#ab114126; RRID:AB_10858797 HRP-conjugated anti-GAPDH Easybio Cat#BE0034 Goat Anti-Rabbit IgG (H&L)-HRP Conjugated Easybio Cat#BE0101-100 KLF4 Antibody Pierce Cat#PA1095; RRID:AB_2539864 Ezrin Antibody (3C12) Pierce Cat#MA513862; RRID:AB_10979020 Donkey anti-Rabbit IgG (H + L) Invitrogen Cat#A31572; RRID:AB_162553 CD3 Monoclonal Antibody (17A2) eBioscience Cat#11-0032-82; RRID:AB_2572431 PE anti-mouse/human CD45R/B220 Antibody biolegend Cat#103028 CD45 Monoclonal Antibody (30-F11) eBioscience Cat#17-0451-82; RRID:AB_469392 Goat anti-Rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen Cat#A-11012; RRID:AB_2534079 Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A-11001; RRID:AB_2534069 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat9664S; RRID:AB_2070042 Bacterial and virus strains Lactobacillus murinus Cultured anaerobically in Gifu Anaerobic Broth (GAM Broth) N/A Biological samples C57BL/6JGpt mice GemPharmatech N/A Chemicals, peptides, and recombinant proteins Gifu Anaerobic Broth (GAM Broth) Hopebio Cat#HB8518 PBS HyClone Cat#SH30256.01 Papain sigmaaldrich Cat#P3125-100MG DNase I coolaber Cat#CD4871 Collagenase I sigmaaldrich Cat#C0130-100MG Collagenase II sigmaaldrich Cat#C6885-100MG Collagenase IV sigmaaldrich Cat#C5138-100MG RIPA Lysis Buffer Beyotime Cat#P0013B PMSF Beyotime Cat#ST506 Protease Inhibitor Cocktail Beyotime Cat#P1010 SDS-PAGE Buffer Beyotime Cat#P0015 RPMI Medium 1640 GIBCO Cat#11875-093 MACS Tissue Storage Solution miltenyi Cat#130-100-008 Debris Removal Solution miltenyi Cat#130-107-677 Fluoromount-G SouthernBiotech Cat#0100-01 DAPI Fluoromount-G SouthernBiotech Cat#0100-20 TRIzolTM Reagent Invitrogen Cat#15596018 acridine orange Invitrogen Cat#A3568 propidium iodide invitrogen Cat#P3566 (Continued on next page) Cell Genomics 5, 100768, February 12, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat#A5670701 Bovine Serum Albumin (BSA) sigmaaldrich Cat#A1933-25G dithiothreitol (DTT) solarbio Cat# D8220 EDTA-Na2 solarbio Cat# E8030 Neutral balsam solarbio Cat#G8590 Water suitable for HPLC sigmaaldrich Cat#270733-2.5L Methanol suitable for UHPLC sigmaaldrich Cat#1037261002 Paraformaldehyde, 4% solarbio Cat#P1110 optimal cutting temperature (O.C.T) sakuraus Cat#4853 DAPI beyotime Cat#C1002 enhanced chemiluminescence (ECL) substrate Easybio Cat#BE6706 Critical commercial assays Chromium Single Cell 30 Kit v2 10x Genomics Cat#CG00052 Adult Brain Dissociation Kit Miltenyi Biotec Cat#130-107-677 Modified Hematoxylin-Eosin(H&E) Stain Kit solarbio Cat#G1121 Deposited data scRNA-seq data This paper https://ngdc.cncb.ac.cn/search/ specific?db=biosample&q=PR PRJCA034312 Experimental models: Organisms/strains Chd8 mutant mice Nanjing Biomedical Research Institute of Nanjing University (NBRI) N/A Chd8 intestinal conditional knockout mice GemPharmatech N/A Cre-positive: C57BL/6JGpt-H11-Vil1-iCre GemPharmatech Cat#T004714 Chd8loxP: C57BL/6JGpt-Chd8em1Cflox/Gpt GemPharmatech Cat#T009485 Oligonucleotides Primers for genotyping, see Table S1 This paper N/A Software and algorithms Cell Ranger v3.1.0 10x Genomics https://support.10xgenomics.com/ single-cell-gene-expression/ software/downloads/latest scanpy v1.6.0 Wof et al.62 https://scanpy.readthedocs.io SCENIC v0.10.3 Van et al.64 https://github.com/aertslab/SCENIC MAST v1.14.0 Finak et al.65 https://rglab.github.io/MAST/ scrublet v0.2.2 Wolock et al.63 https://github.com/swolock/scrublet Scran v1.16.0 Lun et al.66 https://bioconductor.org/packages/ release/bioc/html/scran.html harmonypy v0.0.5 Korsunsky et al.67 https://github.com/immunogenomics/harmony scVelo v0.2.2 Bergen et al.38 https://scvelo.readthedocs.io/en/stable/ scCODA Buttner et al.68 https://sccoda.readthedocs.io/en/ latest/getting_started.html Augur Skinnider et al.25 https://github.com/neurorestore/Augur Cellchat v0.5.0 Jin et al.69 https://github.com/sqjin/CellChat GSEApy v0.10.1 Mootha et al.70 https://gseapy.readthedocs.io/ en/latest/index.html MSigDB Subramanian et al.28 https://www.gsea-msigdb.org/gsea/msigdb g:Profiler Raudvere et al.71 https://biit.cs.ut.ee/gprofiler/ PAGA Wolf et al.72 https://github.com/theislab/paga e2 Cell Genomics 5, 100768, February 12, 2025 OPEN ACCESS OPEN ACCESS
Cell Isolation:Article Title: CD4 + anti-TGF-β CAR T cells and CD8 + conventional CAR T cells exhibit synergistic antitumor effects.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human CD25 Antibody R&D systems Cat# AF-223-NA RRID: AB_354408 Purified anti-human CXCR3 (Maxpar Ready) Antibody Fluidigm Cat# 3163004B Purified anti-human CCR6 (Maxpar Ready) Antibody Fluidigm Cat# 3141003A Anti-Human CD45 (HI30)-89Y Fluidigm Cat# 3089003B TIGIT Monoclonal Antibody (MBSA43), Functional Grade, eBioscienceTM Thermo Cat# 16-9500-82 RRID: AB_10718831 FOXP3 Monoclonal Antibody (PCH101), Functional Grade, eBioscienceTM Thermo Cat# 14-4776-82 RRID: AB_467553 APC/Cyanine7 anti-human CD279 (PD-1) Antibody Biolegend Cat# 367416 RRID: AB_2616744 APC anti-human CD279 (PD-1) Antibody Biolegend Cat# 367406 RRID: AB_2566067 PE/Cyanine7 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369208 RRID: AB_2629835 PerCP/Cyanine5.5 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369216 RRID: AB_2910413 APC anti-human CD3 Antibody Biolegend Cat# 300439 RRID: AB_2562045 PE/Cyanine7 anti-human CD3 Antibody Biolegend Cat# 300420 RRID: AB_439781 APC/Cyanine7 anti-human CD4 Antibody Biolegend Cat# 317418 RRID: AB_571947 PE anti-human CD8 Antibody Biolegend Cat# 303804 RRID: AB_2860786 APC anti-human CD25 Antibody Biolegend Cat# 356110 RRID: AB_2561977 PE/Cyanine7 anti-human CD69 Antibody Biolegend Cat# 310912 RRID: AB_314847 APC anti-human CD69 Antibody Biolegend Cat# 310910 RRID: AB_314845 PE anti-human CD69 Antibody Biolegend Cat# 310906 RRID: AB_314841 PE anti-human NKG2D Antibody Biolegend Cat# 320806 RRID: AB_492960 APC anti-human MICA/B Antibody Biolegend Cat# 320908 RRID: AB_493196 Human ULBP-2/5/6 APC-conjugated Antibody R&D systems Cat# FAB1298A RRID: AB_2257142 Human Mesothelin APC-conjugated Antibody R&D systems Cat# FAB32652A RRID: AB_2298058 APC Mouse IgG1, k Isotype Ctrl Antibody Biolegend Cat# 400120 RRID: AB_2888687 APC anti-mouse IgG2a Antibody Biolegend Cat# 407110 RRID: AB_2561754 SMAD2/3(D7G7) XP Rabbit mAb Cell Signaling Technology Cat# 8685 RRID: 10891619 Phospho-SMAD2(Ser465/467)/SMAD3 (Ser423/425) (D27F4) Rabbit mAb Cell Signaling Technology Cat# 8828 RRID: 2631089 DRP1 (D6C7) Rabbit mAb Cell Signaling Technology Cat# 8570 RRID: AB_10950498 (Continued on next page) e2 Cell Reports Medicine 6, 102020, March 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Phospho-DRP1 (Ser616) (D9A1) Rabbit mAb Cell Signaling Technology Cat# 4494 RRID: AB_11178659 OPA1 (D7C1A) Rabbit mAb Cell Signaling Technology Cat# 67589 RRID: AB_2799728 MFF (E5W4M) XP Rabbit mAb Cell Signaling Technology Cat# 84580 RRID: AB_2799819 SMAD4 (D3R4N) XP Rabbit mAb Cell Signaling Technology Cat# 46535 RRID: AB_2736998 SMAD4 Polyclonal antibody Proteintech Cat# 10231-1-AP RRID: AB_2193323 a-Smooth Muscle Actin (D4K9N) XP Rabbit mAb Cell Signaling Technology Cat# 19245 RRID: AB_2734735 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat# 9664 RRID: 10828837 CD8a (C8/144B) Mouse mAb Cell Signaling Technology Cat# 70306 RRID: AB_2799781 Anti-CD4 antibody Abcam Cat# ab133616 RRID: AB_2750883 Goat Anti-Rabbit IgG H&L (Alexa Fluor 568) Abcam Cat# ab175471 RRID: AB_2576207 Goat Anti-Mouse IgG H&L (Alexa Fluor 647) Abcam Cat# ab150115 RRID: AB_2687948 Biological samples Patient-derived xenografts (PDX) Jiang. et al.,26 Qin. et al.46 N/A Heathy PBMCs Guangzhou Tianhe Noah Biological Engineering Co., LTD NA Chemicals, peptides, and recombinant proteins TGF beta 1 Protein, Human, Rhesus, Cynomolgus, Canine, Recombinant SinoBiological CAS number: 10804-HNAC TMRM MedChemExpress Cat# HY-D0984 MitoTracker Green Yeasen Cat# 40742ES50 MitoTracker Deep Red Yeasen Cat# 40743ES50 GenCRISPRTM Cas9 v1.2 GenScript Cat# Z03702-1 Seahorse XF Cell Mito Stress Test Kit Agilent Cat# 103010-100 Critical commercial assays Human Granzyme B Precoated ELISA Kit DAKEWE Cat# 1118503 Human IFN-g Precoated ELISA Kit DAKEWE Cat# 1110003 Human IL-2 Precoated ELISA Kit DAKEWE Cat# 1110203 Human TGFb1 Precoated ELISA Kit DAKEWE Cat# 1117102 Human PRF1 Precoated ELISA Kit Bioswamp Cat# HM10300 MACS Pan T cell Isolation Kit Miltenyi Biotec Cat# 130-096-535 MACS GMP T cell TransAct Miltenyi Biotec Cat# 170-076-156 Deposited data Original data of the bulk RNAseq This paper GSA-human: HRA001397 Original western blot images This paper https://doi.org/10.17632/n7htzcxmw4.1 Links: https://data.mendeley.com/drafts/ n7htzcxmw4/1 Experimental models: Cell lines Huh7 Procell Cat# CL-0120 HepG2 Procell Cat# CL-0103 (Continued on next page) Cell Reports Medicine 6, 102020, March 18, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER SK-Hep-1 Procell Cat# CL-0212 AsPc-1 Procell Cat# CL-0027 Hela Procell Cat# CL-0292 Jukrat Procell Cat# CL-0315 Experimental models: Organisms/strains Mouse: NSI, NOD-SCID; IL2rg / Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China N/A Oligonucleotides GZMB target gRNA: 50-TGTCTGCCCTGGCTTCACCT-30 GenScript Cat# C080C988G0 IFNG target gRNA: 50-AAAGAGTGTGGAGACCATCA -30 GenScript Cat# C5095GJ130 ctrl target gRNA: 50-CCGGGTCTTCGAGAAGACCT-3-30 GenScript Cat# C2639HE050 Recombinant DNA Anti-TGFb scFv-CD28 CD3z-2A-eGFP This paper N/A Anti-TGFb scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-CD19 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-GPC3 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-MSLN scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A DnTGFbRII-2A-eGFP This paper N/A Anti-TGFb scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Anti-CD19 scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Software and algorithms FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/ downloads Prism 9.0 GraphPad https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.en.softonic.com BioRender BioRender https://www.biorender.com/ BGI Dr. Tom BGI https://biosys.bgi.com/ iDEP iDEP http://bioinformatics.sdstate.edu/idep/
RNA sequencing:Article Title: CD4 + anti-TGF-β CAR T cells and CD8 + conventional CAR T cells exhibit synergistic antitumor effects.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human CD25 Antibody R&D systems Cat# AF-223-NA RRID: AB_354408 Purified anti-human CXCR3 (Maxpar Ready) Antibody Fluidigm Cat# 3163004B Purified anti-human CCR6 (Maxpar Ready) Antibody Fluidigm Cat# 3141003A Anti-Human CD45 (HI30)-89Y Fluidigm Cat# 3089003B TIGIT Monoclonal Antibody (MBSA43), Functional Grade, eBioscienceTM Thermo Cat# 16-9500-82 RRID: AB_10718831 FOXP3 Monoclonal Antibody (PCH101), Functional Grade, eBioscienceTM Thermo Cat# 14-4776-82 RRID: AB_467553 APC/Cyanine7 anti-human CD279 (PD-1) Antibody Biolegend Cat# 367416 RRID: AB_2616744 APC anti-human CD279 (PD-1) Antibody Biolegend Cat# 367406 RRID: AB_2566067 PE/Cyanine7 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369208 RRID: AB_2629835 PerCP/Cyanine5.5 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369216 RRID: AB_2910413 APC anti-human CD3 Antibody Biolegend Cat# 300439 RRID: AB_2562045 PE/Cyanine7 anti-human CD3 Antibody Biolegend Cat# 300420 RRID: AB_439781 APC/Cyanine7 anti-human CD4 Antibody Biolegend Cat# 317418 RRID: AB_571947 PE anti-human CD8 Antibody Biolegend Cat# 303804 RRID: AB_2860786 APC anti-human CD25 Antibody Biolegend Cat# 356110 RRID: AB_2561977 PE/Cyanine7 anti-human CD69 Antibody Biolegend Cat# 310912 RRID: AB_314847 APC anti-human CD69 Antibody Biolegend Cat# 310910 RRID: AB_314845 PE anti-human CD69 Antibody Biolegend Cat# 310906 RRID: AB_314841 PE anti-human NKG2D Antibody Biolegend Cat# 320806 RRID: AB_492960 APC anti-human MICA/B Antibody Biolegend Cat# 320908 RRID: AB_493196 Human ULBP-2/5/6 APC-conjugated Antibody R&D systems Cat# FAB1298A RRID: AB_2257142 Human Mesothelin APC-conjugated Antibody R&D systems Cat# FAB32652A RRID: AB_2298058 APC Mouse IgG1, k Isotype Ctrl Antibody Biolegend Cat# 400120 RRID: AB_2888687 APC anti-mouse IgG2a Antibody Biolegend Cat# 407110 RRID: AB_2561754 SMAD2/3(D7G7) XP Rabbit mAb Cell Signaling Technology Cat# 8685 RRID: 10891619 Phospho-SMAD2(Ser465/467)/SMAD3 (Ser423/425) (D27F4) Rabbit mAb Cell Signaling Technology Cat# 8828 RRID: 2631089 DRP1 (D6C7) Rabbit mAb Cell Signaling Technology Cat# 8570 RRID: AB_10950498 (Continued on next page) e2 Cell Reports Medicine 6, 102020, March 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Phospho-DRP1 (Ser616) (D9A1) Rabbit mAb Cell Signaling Technology Cat# 4494 RRID: AB_11178659 OPA1 (D7C1A) Rabbit mAb Cell Signaling Technology Cat# 67589 RRID: AB_2799728 MFF (E5W4M) XP Rabbit mAb Cell Signaling Technology Cat# 84580 RRID: AB_2799819 SMAD4 (D3R4N) XP Rabbit mAb Cell Signaling Technology Cat# 46535 RRID: AB_2736998 SMAD4 Polyclonal antibody Proteintech Cat# 10231-1-AP RRID: AB_2193323 a-Smooth Muscle Actin (D4K9N) XP Rabbit mAb Cell Signaling Technology Cat# 19245 RRID: AB_2734735 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat# 9664 RRID: 10828837 CD8a (C8/144B) Mouse mAb Cell Signaling Technology Cat# 70306 RRID: AB_2799781 Anti-CD4 antibody Abcam Cat# ab133616 RRID: AB_2750883 Goat Anti-Rabbit IgG H&L (Alexa Fluor 568) Abcam Cat# ab175471 RRID: AB_2576207 Goat Anti-Mouse IgG H&L (Alexa Fluor 647) Abcam Cat# ab150115 RRID: AB_2687948 Biological samples Patient-derived xenografts (PDX) Jiang. et al.,26 Qin. et al.46 N/A Heathy PBMCs Guangzhou Tianhe Noah Biological Engineering Co., LTD NA Chemicals, peptides, and recombinant proteins TGF beta 1 Protein, Human, Rhesus, Cynomolgus, Canine, Recombinant SinoBiological CAS number: 10804-HNAC TMRM MedChemExpress Cat# HY-D0984 MitoTracker Green Yeasen Cat# 40742ES50 MitoTracker Deep Red Yeasen Cat# 40743ES50 GenCRISPRTM Cas9 v1.2 GenScript Cat# Z03702-1 Seahorse XF Cell Mito Stress Test Kit Agilent Cat# 103010-100 Critical commercial assays Human Granzyme B Precoated ELISA Kit DAKEWE Cat# 1118503 Human IFN-g Precoated ELISA Kit DAKEWE Cat# 1110003 Human IL-2 Precoated ELISA Kit DAKEWE Cat# 1110203 Human TGFb1 Precoated ELISA Kit DAKEWE Cat# 1117102 Human PRF1 Precoated ELISA Kit Bioswamp Cat# HM10300 MACS Pan T cell Isolation Kit Miltenyi Biotec Cat# 130-096-535 MACS GMP T cell TransAct Miltenyi Biotec Cat# 170-076-156 Deposited data Original data of the bulk RNAseq This paper GSA-human: HRA001397 Original western blot images This paper https://doi.org/10.17632/n7htzcxmw4.1 Links: https://data.mendeley.com/drafts/ n7htzcxmw4/1 Experimental models: Cell lines Huh7 Procell Cat# CL-0120 HepG2 Procell Cat# CL-0103 (Continued on next page) Cell Reports Medicine 6, 102020, March 18, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER SK-Hep-1 Procell Cat# CL-0212 AsPc-1 Procell Cat# CL-0027 Hela Procell Cat# CL-0292 Jukrat Procell Cat# CL-0315 Experimental models: Organisms/strains Mouse: NSI, NOD-SCID; IL2rg / Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China N/A Oligonucleotides GZMB target gRNA: 50-TGTCTGCCCTGGCTTCACCT-30 GenScript Cat# C080C988G0 IFNG target gRNA: 50-AAAGAGTGTGGAGACCATCA -30 GenScript Cat# C5095GJ130 ctrl target gRNA: 50-CCGGGTCTTCGAGAAGACCT-3-30 GenScript Cat# C2639HE050 Recombinant DNA Anti-TGFb scFv-CD28 CD3z-2A-eGFP This paper N/A Anti-TGFb scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-CD19 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-GPC3 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-MSLN scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A DnTGFbRII-2A-eGFP This paper N/A Anti-TGFb scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Anti-CD19 scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Software and algorithms FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/ downloads Prism 9.0 GraphPad https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.en.softonic.com BioRender BioRender https://www.biorender.com/ BGI Dr. Tom BGI https://biosys.bgi.com/ iDEP iDEP http://bioinformatics.sdstate.edu/idep/
Western Blot:Article Title: CD4 + anti-TGF-β CAR T cells and CD8 + conventional CAR T cells exhibit synergistic antitumor effects.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human CD25 Antibody R&D systems Cat# AF-223-NA RRID: AB_354408 Purified anti-human CXCR3 (Maxpar Ready) Antibody Fluidigm Cat# 3163004B Purified anti-human CCR6 (Maxpar Ready) Antibody Fluidigm Cat# 3141003A Anti-Human CD45 (HI30)-89Y Fluidigm Cat# 3089003B TIGIT Monoclonal Antibody (MBSA43), Functional Grade, eBioscienceTM Thermo Cat# 16-9500-82 RRID: AB_10718831 FOXP3 Monoclonal Antibody (PCH101), Functional Grade, eBioscienceTM Thermo Cat# 14-4776-82 RRID: AB_467553 APC/Cyanine7 anti-human CD279 (PD-1) Antibody Biolegend Cat# 367416 RRID: AB_2616744 APC anti-human CD279 (PD-1) Antibody Biolegend Cat# 367406 RRID: AB_2566067 PE/Cyanine7 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369208 RRID: AB_2629835 PerCP/Cyanine5.5 anti-human CD223 (LAG-3) Antibody Biolegend Cat# 369216 RRID: AB_2910413 APC anti-human CD3 Antibody Biolegend Cat# 300439 RRID: AB_2562045 PE/Cyanine7 anti-human CD3 Antibody Biolegend Cat# 300420 RRID: AB_439781 APC/Cyanine7 anti-human CD4 Antibody Biolegend Cat# 317418 RRID: AB_571947 PE anti-human CD8 Antibody Biolegend Cat# 303804 RRID: AB_2860786 APC anti-human CD25 Antibody Biolegend Cat# 356110 RRID: AB_2561977 PE/Cyanine7 anti-human CD69 Antibody Biolegend Cat# 310912 RRID: AB_314847 APC anti-human CD69 Antibody Biolegend Cat# 310910 RRID: AB_314845 PE anti-human CD69 Antibody Biolegend Cat# 310906 RRID: AB_314841 PE anti-human NKG2D Antibody Biolegend Cat# 320806 RRID: AB_492960 APC anti-human MICA/B Antibody Biolegend Cat# 320908 RRID: AB_493196 Human ULBP-2/5/6 APC-conjugated Antibody R&D systems Cat# FAB1298A RRID: AB_2257142 Human Mesothelin APC-conjugated Antibody R&D systems Cat# FAB32652A RRID: AB_2298058 APC Mouse IgG1, k Isotype Ctrl Antibody Biolegend Cat# 400120 RRID: AB_2888687 APC anti-mouse IgG2a Antibody Biolegend Cat# 407110 RRID: AB_2561754 SMAD2/3(D7G7) XP Rabbit mAb Cell Signaling Technology Cat# 8685 RRID: 10891619 Phospho-SMAD2(Ser465/467)/SMAD3 (Ser423/425) (D27F4) Rabbit mAb Cell Signaling Technology Cat# 8828 RRID: 2631089 DRP1 (D6C7) Rabbit mAb Cell Signaling Technology Cat# 8570 RRID: AB_10950498 (Continued on next page) e2 Cell Reports Medicine 6, 102020, March 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Phospho-DRP1 (Ser616) (D9A1) Rabbit mAb Cell Signaling Technology Cat# 4494 RRID: AB_11178659 OPA1 (D7C1A) Rabbit mAb Cell Signaling Technology Cat# 67589 RRID: AB_2799728 MFF (E5W4M) XP Rabbit mAb Cell Signaling Technology Cat# 84580 RRID: AB_2799819 SMAD4 (D3R4N) XP Rabbit mAb Cell Signaling Technology Cat# 46535 RRID: AB_2736998 SMAD4 Polyclonal antibody Proteintech Cat# 10231-1-AP RRID: AB_2193323 a-Smooth Muscle Actin (D4K9N) XP Rabbit mAb Cell Signaling Technology Cat# 19245 RRID: AB_2734735 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat# 9664 RRID: 10828837 CD8a (C8/144B) Mouse mAb Cell Signaling Technology Cat# 70306 RRID: AB_2799781 Anti-CD4 antibody Abcam Cat# ab133616 RRID: AB_2750883 Goat Anti-Rabbit IgG H&L (Alexa Fluor 568) Abcam Cat# ab175471 RRID: AB_2576207 Goat Anti-Mouse IgG H&L (Alexa Fluor 647) Abcam Cat# ab150115 RRID: AB_2687948 Biological samples Patient-derived xenografts (PDX) Jiang. et al.,26 Qin. et al.46 N/A Heathy PBMCs Guangzhou Tianhe Noah Biological Engineering Co., LTD NA Chemicals, peptides, and recombinant proteins TGF beta 1 Protein, Human, Rhesus, Cynomolgus, Canine, Recombinant SinoBiological CAS number: 10804-HNAC TMRM MedChemExpress Cat# HY-D0984 MitoTracker Green Yeasen Cat# 40742ES50 MitoTracker Deep Red Yeasen Cat# 40743ES50 GenCRISPRTM Cas9 v1.2 GenScript Cat# Z03702-1 Seahorse XF Cell Mito Stress Test Kit Agilent Cat# 103010-100 Critical commercial assays Human Granzyme B Precoated ELISA Kit DAKEWE Cat# 1118503 Human IFN-g Precoated ELISA Kit DAKEWE Cat# 1110003 Human IL-2 Precoated ELISA Kit DAKEWE Cat# 1110203 Human TGFb1 Precoated ELISA Kit DAKEWE Cat# 1117102 Human PRF1 Precoated ELISA Kit Bioswamp Cat# HM10300 MACS Pan T cell Isolation Kit Miltenyi Biotec Cat# 130-096-535 MACS GMP T cell TransAct Miltenyi Biotec Cat# 170-076-156 Deposited data Original data of the bulk RNAseq This paper GSA-human: HRA001397 Original western blot images This paper https://doi.org/10.17632/n7htzcxmw4.1 Links: https://data.mendeley.com/drafts/ n7htzcxmw4/1 Experimental models: Cell lines Huh7 Procell Cat# CL-0120 HepG2 Procell Cat# CL-0103 (Continued on next page) Cell Reports Medicine 6, 102020, March 18, 2025 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER SK-Hep-1 Procell Cat# CL-0212 AsPc-1 Procell Cat# CL-0027 Hela Procell Cat# CL-0292 Jukrat Procell Cat# CL-0315 Experimental models: Organisms/strains Mouse: NSI, NOD-SCID; IL2rg / Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, China N/A Oligonucleotides GZMB target gRNA: 50-TGTCTGCCCTGGCTTCACCT-30 GenScript Cat# C080C988G0 IFNG target gRNA: 50-AAAGAGTGTGGAGACCATCA -30 GenScript Cat# C5095GJ130 ctrl target gRNA: 50-CCGGGTCTTCGAGAAGACCT-3-30 GenScript Cat# C2639HE050 Recombinant DNA Anti-TGFb scFv-CD28 CD3z-2A-eGFP This paper N/A Anti-TGFb scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-CD19 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-GPC3 scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A Anti-MSLN scFv-CD28 CD3z-TLR2-2AeGFP This paper N/A DnTGFbRII-2A-eGFP This paper N/A Anti-TGFb scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Anti-CD19 scFv-mCD28-mCD3z-mTLR22A-eGFP This paper N/A Software and algorithms FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/ downloads Prism 9.0 GraphPad https://www.graphpad.com/ scientificsoftware/prism/ ImageJ National Institutes of Health https://imagej.en.softonic.com BioRender BioRender https://www.biorender.com/ BGI Dr. Tom BGI https://biosys.bgi.com/ iDEP iDEP http://bioinformatics.sdstate.edu/idep/
Purification:Article Title: Enhanced differentiation of neural progenitor cells in Alzheimer's disease into vulnerable immature neurons.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-SOX2 antibody Abcam Cat# ab97959; RRID:AB_2341193 Anti-Doublecortin (DCX) antibody Abcam Cat# ab18723; RRID:AB_732011 Neuronal Class III beta-Tubulin (TUJ1) Monoclonal Antibody, Purified BioLegend Cat# 801201; RRID:AB_2313773 GAPDH (6C5) Santa Cruz Biotechnology Cat# sc-32233; RRID:AB_627679 Anti-Nestin, human, clone 10C2 Millipore Cat# MAB5326; RRID:AB_2251134 Human Nestin Phycoerythrin (PE)-conjugated Antibody R&D Systems Cat# IC1259P; RRID:AB_2151147 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat# 9664; RRID:AB_2070042 Anti-phospho-Histone H2A.X (Ser139) Antibody, clone JBW301 Millipore Cat# 05-636; RRID:AB_309864 Chemicals, peptides, and recombinant proteins hESC-qualified matrigel Corning Cat# 356277 mTeSR1 StemCell Technologies Cat# 85850 DMEM/F-12, GlutaMAXTM supplement Gibco Cat# 10565018 NeurobasalTM Medium Gibco Cat# 21103049 MEM Non-essential Amino Acid Solution (100×) Merck Cat# M7145 GlutaMAXTM Supplement Gibco Cat# 35050061 Insulin solution human Sigma-Aldrich Cat# I9278 2-Mercaptoethanol Sigma-Aldrich Cat# M3148 Penicillin-Streptomycin (10,000 U/mL) Gibco Cat# 15140122 B-27TM supplement (50X), serum free Gibco Cat# 17504044 N-2 Supplement (100X) Gibco Cat# 17502001 Dorsomorphin dihydrochloride Tocris Cat# 3093 SB 431542 Tocris Cat# 1614 Recombinant Human FGF-basic (154 a.a.) PeproTech Cat# 100-18B ACCUTASETM StemCell Technologies Cat# 07922 Recombinant Human/Murine/Rat BDNF PeproTech Cat# 450-02 Recombinant Human GDNF PeproTech Cat# 450-10 Glasgow’s MEM (GMEM) Gibco Cat# 11710035 KnockOutTM Serum Replacement Gibco Cat# 10828010 Sodium Pyruvate (100 mM) Gibco Cat# 11360070 endo-IWR 1 Tocris Cat# 3532 Chemically Defined Lipid Concentrate Gibco Cat# 11905031 DPBS Biowest Cat# L0615-500 Tris Duchefa Biochemie Cat# T1501 NaCl Sigma-Aldrich Cat# 9888 NP-40 Sigma-Aldrich Cat# I8896 Sodium deoxycholate Sigma-Aldrich Cat# 264103 SDS Sigma-Aldrich Cat# 62862 TritonTM X-100 Sigma-Aldrich Cat# T9284 BSA assay kit Bio-Rad Cat# 5000006 Tween® 20, Molecular Biology Grade Promega Cat# H5151 Fisher Healthcare Tissue-PlusTM O.C.T. .. Compound Thermo Fisher Scientific Cat# 23-730-571 Skim Milk Powder MB cell Cat# MB-S1667 (Continued on next page) e1 iScience 28, 112446, May 16, 2025
Virus:Article Title: Unified modeling of 3D molecular generation via atomic interactions with PocketXMol.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Caspase-9 (C9) Mouse mAb Cell Signaling Technology Cat# 9508; RRID: AB_2068620 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat# 9664; RRID: AB_2070042 β-Actin (13E5) Rabbit mAb Cell Signaling Technology Cat# 4970; RRID: AB_2223172 Caspase-3 Antibody Cell Signaling Technology Cat# 9662; RRID: AB_331439 PARP Antibody Cell Signaling Technology Cat# 9542; RRID: AB_2160739 Alexa Fluor® 594 Anti-PD-L1 antibody (28-8) Abcam Cat # ab213360 Bacterial and virus strains BL21-CodonPlus (DE3)-RILP Competent Cells Agilent Technologies Cat# 230280 Chemicals, peptides, and recombinant proteins ABT-737 Selleck Cat# S1002 Q-VD-Oph Selleck Cat# S7311 Emricasan Selleck Cat# S7775 Recombinant Caspase 3 , Human MedChemExpress Cat# HY-P701341 84663 WuXi AppTec N/A D12 WuXi AppTec N/A D13 WuXi AppTec N/A D18 WuXi AppTec N/A D19 WuXi AppTec N/A Recombinant Human PD-L1 Protein Sino Biological, Inc. Cat#10084-H08H Recombinant Human PD-1 Protein Sino Biological, Inc. Cat#10377-H08H indocyanine green (ICG) RuixiBiotech Co., Ltd. R-H-3102 Peptide GenScript https://www.genscript.com/peptide- services.html?=home Critical commercial assays Caspase 3/7 Activity Assay Kit(Colorimetric Method) Elabscience Cat# E-CK-A383 Ac-DEVD-pNA Elabscience Cat# E-CK-A383 Deposited data Processed dataset for training and evaluation This study Zenodo: https://doi.org/10.5281/zenodo. .. 17801271 PDBBind Liu et al.15 http://pdbbind.org.cn Binding MOAD Benson et al.16 https://pubmed.ncbi.nlm.nih.gov/ 18055497/ CrossDocked2020 Francoeur et al.17 https://github.com/gnina/models/tree/ master/data/CrossDocked2020 PepBDB Wen et al.18 http://huanglab.phys.hust.edu.cn/pepbdb/ AlphaFold DB Varadi et al.1 https://alphafold.ebi.ac.uk/ ChEMBL Gaulton et al.19 https://www.ebi.ac.uk/chembl/ ZINC20 Irwin et al.20 https://zinc20.docking.org/ GEOM dataset Axelrod et al.21 https://github.com/learningmatter-mit/ geom CREMP Grambow et al.22 https://zenodo.org/records/8010582 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–19.e1–e17, April 2, 2026 Please cite this article in press as: Peng et al., Unified modeling of 3D molecular generation via atomic interactions with PocketXMol, Cell (2026), https://doi.org/10.1016/j.cell.2026.01.003 Article
Article Title: Single-cell delineation of the microbiota-gut-brain axis: Probiotic intervention in Chd8 haploinsufficient mice.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CHD8 Abcam Cat#ab114126; RRID:AB_10858797 HRP-conjugated anti-GAPDH Easybio Cat#BE0034 Goat Anti-Rabbit IgG (H&L)-HRP Conjugated Easybio Cat#BE0101-100 KLF4 Antibody Pierce Cat#PA1095; RRID:AB_2539864 Ezrin Antibody (3C12) Pierce Cat#MA513862; RRID:AB_10979020 Donkey anti-Rabbit IgG (H + L) Invitrogen Cat#A31572; RRID:AB_162553 CD3 Monoclonal Antibody (17A2) eBioscience Cat#11-0032-82; RRID:AB_2572431 PE anti-mouse/human CD45R/B220 Antibody biolegend Cat#103028 CD45 Monoclonal Antibody (30-F11) eBioscience Cat#17-0451-82; RRID:AB_469392 Goat anti-Rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen Cat#A-11012; RRID:AB_2534079 Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A-11001; RRID:AB_2534069 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat9664S; RRID:AB_2070042 Bacterial and virus strains Lactobacillus murinus Cultured anaerobically in Gifu Anaerobic Broth (GAM Broth) N/A Biological samples C57BL/6JGpt mice GemPharmatech N/A Chemicals, peptides, and recombinant proteins Gifu Anaerobic Broth (GAM Broth) Hopebio Cat#HB8518 PBS HyClone Cat#SH30256.01 Papain sigmaaldrich Cat#P3125-100MG DNase I coolaber Cat#CD4871 Collagenase I sigmaaldrich Cat#C0130-100MG Collagenase II sigmaaldrich Cat#C6885-100MG Collagenase IV sigmaaldrich Cat#C5138-100MG RIPA Lysis Buffer Beyotime Cat#P0013B PMSF Beyotime Cat#ST506 Protease Inhibitor Cocktail Beyotime Cat#P1010 SDS-PAGE Buffer Beyotime Cat#P0015 RPMI Medium 1640 GIBCO Cat#11875-093 MACS Tissue Storage Solution miltenyi Cat#130-100-008 Debris Removal Solution miltenyi Cat#130-107-677 Fluoromount-G SouthernBiotech Cat#0100-01 DAPI Fluoromount-G SouthernBiotech Cat#0100-20 TRIzolTM Reagent Invitrogen Cat#15596018 acridine orange Invitrogen Cat#A3568 propidium iodide invitrogen Cat#P3566 (Continued on next page) Cell Genomics 5, 100768, February 12, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat#A5670701 Bovine Serum Albumin (BSA) sigmaaldrich Cat#A1933-25G dithiothreitol (DTT) solarbio Cat# D8220 EDTA-Na2 solarbio Cat# E8030 Neutral balsam solarbio Cat#G8590 Water suitable for HPLC sigmaaldrich Cat#270733-2.5L Methanol suitable for UHPLC sigmaaldrich Cat#1037261002 Paraformaldehyde, 4% solarbio Cat#P1110 optimal cutting temperature (O.C.T) sakuraus Cat#4853 DAPI beyotime Cat#C1002 enhanced chemiluminescence (ECL) substrate Easybio Cat#BE6706 Critical commercial assays Chromium Single Cell 30 Kit v2 10x Genomics Cat#CG00052 Adult Brain Dissociation Kit Miltenyi Biotec Cat#130-107-677 Modified Hematoxylin-Eosin(H&E) Stain Kit solarbio Cat#G1121 Deposited data scRNA-seq data This paper https://ngdc.cncb.ac.cn/search/ specific?db=biosample&q=PR PRJCA034312 Experimental models: Organisms/strains Chd8 mutant mice Nanjing Biomedical Research Institute of Nanjing University (NBRI) N/A Chd8 intestinal conditional knockout mice GemPharmatech N/A Cre-positive: C57BL/6JGpt-H11-Vil1-iCre GemPharmatech Cat#T004714 Chd8loxP: C57BL/6JGpt-Chd8em1Cflox/Gpt GemPharmatech Cat#T009485 Oligonucleotides Primers for genotyping, see Table S1 This paper N/A Software and algorithms Cell Ranger v3.1.0 10x Genomics https://support.10xgenomics.com/ single-cell-gene-expression/ software/downloads/latest scanpy v1.6.0 Wof et al.62 https://scanpy.readthedocs.io SCENIC v0.10.3 Van et al.64 https://github.com/aertslab/SCENIC MAST v1.14.0 Finak et al.65 https://rglab.github.io/MAST/ scrublet v0.2.2 Wolock et al.63 https://github.com/swolock/scrublet Scran v1.16.0 Lun et al.66 https://bioconductor.org/packages/ release/bioc/html/scran.html harmonypy v0.0.5 Korsunsky et al.67 https://github.com/immunogenomics/harmony scVelo v0.2.2 Bergen et al.38 https://scvelo.readthedocs.io/en/stable/ scCODA Buttner et al.68 https://sccoda.readthedocs.io/en/ latest/getting_started.html Augur Skinnider et al.25 https://github.com/neurorestore/Augur Cellchat v0.5.0 Jin et al.69 https://github.com/sqjin/CellChat GSEApy v0.10.1 Mootha et al.70 https://gseapy.readthedocs.io/ en/latest/index.html MSigDB Subramanian et al.28 https://www.gsea-msigdb.org/gsea/msigdb g:Profiler Raudvere et al.71 https://biit.cs.ut.ee/gprofiler/ PAGA Wolf et al.72 https://github.com/theislab/paga e2 Cell Genomics 5, 100768, February 12, 2025 OPEN ACCESS OPEN ACCESS
Article Title: PI5P4Kα promotes glucose and iron acquisition to support metabolic fitness in pancreatic cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PIP4K2A (D83C1) Rabbit mAb Cell signaling Technology Cat# 5527; RRID:AB_2722636 PARP (46D11) Rabbit mAb Cell signaling Technology Cat# 9532; RRID:AB_659884 p62/SQSTM1 (2C11) mouse mAb Abnova Cat# H00008878-M01; RRID:AB_437085 LC3A/B (D3U4C) Rabbit mAb Cell signaling Technology Cat# 12741; RRID:AB_2617131 Tubulin (TUBA1) mouse mAb Millipore Sigma Cat# T6199; RRID:AB_477583 Phospho-histone H3 (Ser10) Rabbit mAb Cell signaling Technology Cat# 9701; RRID:AB_331535 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell signaling Technology Cat# 9664; RRID:AB_2070042 IRDye® 680LT Goat anti-mouse IgG secondary Ab LICORbio Cat# 926–68020; RRID:AB_2687826 IRDye® 800CW Goat anti-Rabbit IgG secondary Ab LICORbio Cat# 926–32211; RRID:AB_621843 Glut1 (E4S6I) Rabbit mAb Cell signaling Technology Cat# 73015; RRID:AB_3064908 ASNS Polyclonal antibody Proteintech Cat#14681-1-AP; RRID: AB_2060119 CD71 antibody, anti-human, PE, REAfinityTM, REA902 | AC102 Miltenyi Biotec Cat#130-115-029; RRID:AB_2726859 Bacterial and virus strains Lentivirus Produced using pLKO.1-puro shRNA system in HEK293T cells N/A DH5α E. coli Zymo research Cat# T3007 Biological samples Mouse pancreatic tumors Sanford Burnham Prebys Medical Discovery Institute vivarium N/A Human PDAC tissue samples University of Bern N/A Chemicals, peptides, and recombinant proteins Polybrene Santa Cruz Biotechnology Cat# SC134220 Formaldehyde 37% RICCA chemical company Cat# RSOF0010 Crystal violet Millipore Sigma Cat# C0775 Emricasan MedKoo Biosciences Cat# 510230 Tetramethylrhodamine, Ethyl Ester, Perchlorate (TMRE) ThermoFisher Scientific Cat# T669 Transferrin (human) CF® 594 Conjugate Biotium Cat# #00084 DAPI (4′,6-Diamidino-2Phenylindole, Dilactate) BioLegend Cat# 422801 Hoechst 33342 MP Biomedicals Cat# 0219030525 Doxycycline hyclate Millipore Sigma Cat# D9891 Sodium L-lactate Millipore Sigma Cat# 71718 Sodium pyruvate ThermoFisher Scientific Cat# 11360070 Dimethyl 2-oxoglutarate Millipore Sigma Cat# 349631 Dimethyl DL-Glutamate (hydrochloride) Cayman chemical Cat# 18602 Ammonium iron(III) citrate (FAC) Millipore Sigma Cat# F5879 Ferrostatin-1 Fisher Scientific Cat# 50-225-9214 Sodium citrate VWR Cat# 0101 Bafilomycin A1 Selleckchem Cat# S1413 DMEM with L-Glutamine and 4.5g/L glucose; without sodium pyruvate Corning Cat# 10017CV (Continued on next page) 16 Cell Reports 44, 116199, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mouse: Nude (Foxn1nu) The Jackson Laboratory Cat# 002019; RRID:IMSR_JAX:002019 Oligonucleotides PIP4K2A-F Custom DNA Oligos CGTAGCGCAGAAAGTGAAGC PIP4K2A-R Custom DNA Oligos GGCTCGGCATGTTTTCTTTGT Recombinant DNA pLKO.1 puro Addgene Cat# 8453 psPAX2 Addgene Cat# 12260 pVSV-G Addgene Cat# 138479 pCL-Ampho Novus biologicals Cat# NBP2-29541 pLKO.1 shSCR Addgene Cat# 17920 pLKO.1-puro-sh α1 Lab-generated sh α#1-TRCN0000220609; 5′- CCTCGGACAGACATGAACATT-3′ pLKO.1-puro-sh α2 Lab-generated sh α#2 -TRCN0000195145; 5′- CCAGCATCGTTCTAGCTATTT-3′ Tet-pLKO-puro Addgene Cat# 21915 Tet-pLKO-puro-sh α1 Lab-generated sh α#1-TRCN0000220609; 5′- CCTCGGACAGACATGAACATT-3′ Tet-pLKO-puro-sh α2 Lab-generated sh α#2 -TRCN0000195145; 5′- CCAGCATCGTTCTAGCTATTT-3′ mCherry-eGFP-LC3B NovoPro Cat# V012182 Software and algorithms GraphPad Prism version 10.0.0 GraphPad software RRID:SCR_002798; https://www.graphpad.com Fiji (ImageJ) NIH RRID:SCR_002285; https://fiji.sc BioTek Gen5 Agilent Technologies RRID:SCR_017317; https://www.agilent.com/en/ support/biotek-software-releases FACSDiVa v8.0.2.
Activity Assay:Article Title: Unified modeling of 3D molecular generation via atomic interactions with PocketXMol.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Caspase-9 (C9) Mouse mAb Cell Signaling Technology Cat# 9508; RRID: AB_2068620 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat# 9664; RRID: AB_2070042 β-Actin (13E5) Rabbit mAb Cell Signaling Technology Cat# 4970; RRID: AB_2223172 Caspase-3 Antibody Cell Signaling Technology Cat# 9662; RRID: AB_331439 PARP Antibody Cell Signaling Technology Cat# 9542; RRID: AB_2160739 Alexa Fluor® 594 Anti-PD-L1 antibody (28-8) Abcam Cat # ab213360 Bacterial and virus strains BL21-CodonPlus (DE3)-RILP Competent Cells Agilent Technologies Cat# 230280 Chemicals, peptides, and recombinant proteins ABT-737 Selleck Cat# S1002 Q-VD-Oph Selleck Cat# S7311 Emricasan Selleck Cat# S7775 Recombinant Caspase 3 , Human MedChemExpress Cat# HY-P701341 84663 WuXi AppTec N/A D12 WuXi AppTec N/A D13 WuXi AppTec N/A D18 WuXi AppTec N/A D19 WuXi AppTec N/A Recombinant Human PD-L1 Protein Sino Biological, Inc. Cat#10084-H08H Recombinant Human PD-1 Protein Sino Biological, Inc. Cat#10377-H08H indocyanine green (ICG) RuixiBiotech Co., Ltd. R-H-3102 Peptide GenScript https://www.genscript.com/peptide- services.html?=home Critical commercial assays Caspase 3/7 Activity Assay Kit(Colorimetric Method) Elabscience Cat# E-CK-A383 Ac-DEVD-pNA Elabscience Cat# E-CK-A383 Deposited data Processed dataset for training and evaluation This study Zenodo: https://doi.org/10.5281/zenodo. .. 17801271 PDBBind Liu et al.15 http://pdbbind.org.cn Binding MOAD Benson et al.16 https://pubmed.ncbi.nlm.nih.gov/ 18055497/ CrossDocked2020 Francoeur et al.17 https://github.com/gnina/models/tree/ master/data/CrossDocked2020 PepBDB Wen et al.18 http://huanglab.phys.hust.edu.cn/pepbdb/ AlphaFold DB Varadi et al.1 https://alphafold.ebi.ac.uk/ ChEMBL Gaulton et al.19 https://www.ebi.ac.uk/chembl/ ZINC20 Irwin et al.20 https://zinc20.docking.org/ GEOM dataset Axelrod et al.21 https://github.com/learningmatter-mit/ geom CREMP Grambow et al.22 https://zenodo.org/records/8010582 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–19.e1–e17, April 2, 2026 Please cite this article in press as: Peng et al., Unified modeling of 3D molecular generation via atomic interactions with PocketXMol, Cell (2026), https://doi.org/10.1016/j.cell.2026.01.003 Article
Cell Culture:Article Title: Single-cell delineation of the microbiota-gut-brain axis: Probiotic intervention in Chd8 haploinsufficient mice.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CHD8 Abcam Cat#ab114126; RRID:AB_10858797 HRP-conjugated anti-GAPDH Easybio Cat#BE0034 Goat Anti-Rabbit IgG (H&L)-HRP Conjugated Easybio Cat#BE0101-100 KLF4 Antibody Pierce Cat#PA1095; RRID:AB_2539864 Ezrin Antibody (3C12) Pierce Cat#MA513862; RRID:AB_10979020 Donkey anti-Rabbit IgG (H + L) Invitrogen Cat#A31572; RRID:AB_162553 CD3 Monoclonal Antibody (17A2) eBioscience Cat#11-0032-82; RRID:AB_2572431 PE anti-mouse/human CD45R/B220 Antibody biolegend Cat#103028 CD45 Monoclonal Antibody (30-F11) eBioscience Cat#17-0451-82; RRID:AB_469392 Goat anti-Rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen Cat#A-11012; RRID:AB_2534079 Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A-11001; RRID:AB_2534069 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat9664S; RRID:AB_2070042 Bacterial and virus strains Lactobacillus murinus Cultured anaerobically in Gifu Anaerobic Broth (GAM Broth) N/A Biological samples C57BL/6JGpt mice GemPharmatech N/A Chemicals, peptides, and recombinant proteins Gifu Anaerobic Broth (GAM Broth) Hopebio Cat#HB8518 PBS HyClone Cat#SH30256.01 Papain sigmaaldrich Cat#P3125-100MG DNase I coolaber Cat#CD4871 Collagenase I sigmaaldrich Cat#C0130-100MG Collagenase II sigmaaldrich Cat#C6885-100MG Collagenase IV sigmaaldrich Cat#C5138-100MG RIPA Lysis Buffer Beyotime Cat#P0013B PMSF Beyotime Cat#ST506 Protease Inhibitor Cocktail Beyotime Cat#P1010 SDS-PAGE Buffer Beyotime Cat#P0015 RPMI Medium 1640 GIBCO Cat#11875-093 MACS Tissue Storage Solution miltenyi Cat#130-100-008 Debris Removal Solution miltenyi Cat#130-107-677 Fluoromount-G SouthernBiotech Cat#0100-01 DAPI Fluoromount-G SouthernBiotech Cat#0100-20 TRIzolTM Reagent Invitrogen Cat#15596018 acridine orange Invitrogen Cat#A3568 propidium iodide invitrogen Cat#P3566 (Continued on next page) Cell Genomics 5, 100768, February 12, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat#A5670701 Bovine Serum Albumin (BSA) sigmaaldrich Cat#A1933-25G dithiothreitol (DTT) solarbio Cat# D8220 EDTA-Na2 solarbio Cat# E8030 Neutral balsam solarbio Cat#G8590 Water suitable for HPLC sigmaaldrich Cat#270733-2.5L Methanol suitable for UHPLC sigmaaldrich Cat#1037261002 Paraformaldehyde, 4% solarbio Cat#P1110 optimal cutting temperature (O.C.T) sakuraus Cat#4853 DAPI beyotime Cat#C1002 enhanced chemiluminescence (ECL) substrate Easybio Cat#BE6706 Critical commercial assays Chromium Single Cell 30 Kit v2 10x Genomics Cat#CG00052 Adult Brain Dissociation Kit Miltenyi Biotec Cat#130-107-677 Modified Hematoxylin-Eosin(H&E) Stain Kit solarbio Cat#G1121 Deposited data scRNA-seq data This paper https://ngdc.cncb.ac.cn/search/ specific?db=biosample&q=PR PRJCA034312 Experimental models: Organisms/strains Chd8 mutant mice Nanjing Biomedical Research Institute of Nanjing University (NBRI) N/A Chd8 intestinal conditional knockout mice GemPharmatech N/A Cre-positive: C57BL/6JGpt-H11-Vil1-iCre GemPharmatech Cat#T004714 Chd8loxP: C57BL/6JGpt-Chd8em1Cflox/Gpt GemPharmatech Cat#T009485 Oligonucleotides Primers for genotyping, see Table S1 This paper N/A Software and algorithms Cell Ranger v3.1.0 10x Genomics https://support.10xgenomics.com/ single-cell-gene-expression/ software/downloads/latest scanpy v1.6.0 Wof et al.62 https://scanpy.readthedocs.io SCENIC v0.10.3 Van et al.64 https://github.com/aertslab/SCENIC MAST v1.14.0 Finak et al.65 https://rglab.github.io/MAST/ scrublet v0.2.2 Wolock et al.63 https://github.com/swolock/scrublet Scran v1.16.0 Lun et al.66 https://bioconductor.org/packages/ release/bioc/html/scran.html harmonypy v0.0.5 Korsunsky et al.67 https://github.com/immunogenomics/harmony scVelo v0.2.2 Bergen et al.38 https://scvelo.readthedocs.io/en/stable/ scCODA Buttner et al.68 https://sccoda.readthedocs.io/en/ latest/getting_started.html Augur Skinnider et al.25 https://github.com/neurorestore/Augur Cellchat v0.5.0 Jin et al.69 https://github.com/sqjin/CellChat GSEApy v0.10.1 Mootha et al.70 https://gseapy.readthedocs.io/ en/latest/index.html MSigDB Subramanian et al.28 https://www.gsea-msigdb.org/gsea/msigdb g:Profiler Raudvere et al.71 https://biit.cs.ut.ee/gprofiler/ PAGA Wolf et al.72 https://github.com/theislab/paga e2 Cell Genomics 5, 100768, February 12, 2025 OPEN ACCESS OPEN ACCESS
Lysis:Article Title: Single-cell delineation of the microbiota-gut-brain axis: Probiotic intervention in Chd8 haploinsufficient mice.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CHD8 Abcam Cat#ab114126; RRID:AB_10858797 HRP-conjugated anti-GAPDH Easybio Cat#BE0034 Goat Anti-Rabbit IgG (H&L)-HRP Conjugated Easybio Cat#BE0101-100 KLF4 Antibody Pierce Cat#PA1095; RRID:AB_2539864 Ezrin Antibody (3C12) Pierce Cat#MA513862; RRID:AB_10979020 Donkey anti-Rabbit IgG (H + L) Invitrogen Cat#A31572; RRID:AB_162553 CD3 Monoclonal Antibody (17A2) eBioscience Cat#11-0032-82; RRID:AB_2572431 PE anti-mouse/human CD45R/B220 Antibody biolegend Cat#103028 CD45 Monoclonal Antibody (30-F11) eBioscience Cat#17-0451-82; RRID:AB_469392 Goat anti-Rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen Cat#A-11012; RRID:AB_2534079 Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A-11001; RRID:AB_2534069 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat9664S; RRID:AB_2070042 Bacterial and virus strains Lactobacillus murinus Cultured anaerobically in Gifu Anaerobic Broth (GAM Broth) N/A Biological samples C57BL/6JGpt mice GemPharmatech N/A Chemicals, peptides, and recombinant proteins Gifu Anaerobic Broth (GAM Broth) Hopebio Cat#HB8518 PBS HyClone Cat#SH30256.01 Papain sigmaaldrich Cat#P3125-100MG DNase I coolaber Cat#CD4871 Collagenase I sigmaaldrich Cat#C0130-100MG Collagenase II sigmaaldrich Cat#C6885-100MG Collagenase IV sigmaaldrich Cat#C5138-100MG RIPA Lysis Buffer Beyotime Cat#P0013B PMSF Beyotime Cat#ST506 Protease Inhibitor Cocktail Beyotime Cat#P1010 SDS-PAGE Buffer Beyotime Cat#P0015 RPMI Medium 1640 GIBCO Cat#11875-093 MACS Tissue Storage Solution miltenyi Cat#130-100-008 Debris Removal Solution miltenyi Cat#130-107-677 Fluoromount-G SouthernBiotech Cat#0100-01 DAPI Fluoromount-G SouthernBiotech Cat#0100-20 TRIzolTM Reagent Invitrogen Cat#15596018 acridine orange Invitrogen Cat#A3568 propidium iodide invitrogen Cat#P3566 (Continued on next page) Cell Genomics 5, 100768, February 12, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat#A5670701 Bovine Serum Albumin (BSA) sigmaaldrich Cat#A1933-25G dithiothreitol (DTT) solarbio Cat# D8220 EDTA-Na2 solarbio Cat# E8030 Neutral balsam solarbio Cat#G8590 Water suitable for HPLC sigmaaldrich Cat#270733-2.5L Methanol suitable for UHPLC sigmaaldrich Cat#1037261002 Paraformaldehyde, 4% solarbio Cat#P1110 optimal cutting temperature (O.C.T) sakuraus Cat#4853 DAPI beyotime Cat#C1002 enhanced chemiluminescence (ECL) substrate Easybio Cat#BE6706 Critical commercial assays Chromium Single Cell 30 Kit v2 10x Genomics Cat#CG00052 Adult Brain Dissociation Kit Miltenyi Biotec Cat#130-107-677 Modified Hematoxylin-Eosin(H&E) Stain Kit solarbio Cat#G1121 Deposited data scRNA-seq data This paper https://ngdc.cncb.ac.cn/search/ specific?db=biosample&q=PR PRJCA034312 Experimental models: Organisms/strains Chd8 mutant mice Nanjing Biomedical Research Institute of Nanjing University (NBRI) N/A Chd8 intestinal conditional knockout mice GemPharmatech N/A Cre-positive: C57BL/6JGpt-H11-Vil1-iCre GemPharmatech Cat#T004714 Chd8loxP: C57BL/6JGpt-Chd8em1Cflox/Gpt GemPharmatech Cat#T009485 Oligonucleotides Primers for genotyping, see Table S1 This paper N/A Software and algorithms Cell Ranger v3.1.0 10x Genomics https://support.10xgenomics.com/ single-cell-gene-expression/ software/downloads/latest scanpy v1.6.0 Wof et al.62 https://scanpy.readthedocs.io SCENIC v0.10.3 Van et al.64 https://github.com/aertslab/SCENIC MAST v1.14.0 Finak et al.65 https://rglab.github.io/MAST/ scrublet v0.2.2 Wolock et al.63 https://github.com/swolock/scrublet Scran v1.16.0 Lun et al.66 https://bioconductor.org/packages/ release/bioc/html/scran.html harmonypy v0.0.5 Korsunsky et al.67 https://github.com/immunogenomics/harmony scVelo v0.2.2 Bergen et al.38 https://scvelo.readthedocs.io/en/stable/ scCODA Buttner et al.68 https://sccoda.readthedocs.io/en/ latest/getting_started.html Augur Skinnider et al.25 https://github.com/neurorestore/Augur Cellchat v0.5.0 Jin et al.69 https://github.com/sqjin/CellChat GSEApy v0.10.1 Mootha et al.70 https://gseapy.readthedocs.io/ en/latest/index.html MSigDB Subramanian et al.28 https://www.gsea-msigdb.org/gsea/msigdb g:Profiler Raudvere et al.71 https://biit.cs.ut.ee/gprofiler/ PAGA Wolf et al.72 https://github.com/theislab/paga e2 Cell Genomics 5, 100768, February 12, 2025 OPEN ACCESS OPEN ACCESS
SDS Page:Article Title: Single-cell delineation of the microbiota-gut-brain axis: Probiotic intervention in Chd8 haploinsufficient mice.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-CHD8 Abcam Cat#ab114126; RRID:AB_10858797 HRP-conjugated anti-GAPDH Easybio Cat#BE0034 Goat Anti-Rabbit IgG (H&L)-HRP Conjugated Easybio Cat#BE0101-100 KLF4 Antibody Pierce Cat#PA1095; RRID:AB_2539864 Ezrin Antibody (3C12) Pierce Cat#MA513862; RRID:AB_10979020 Donkey anti-Rabbit IgG (H + L) Invitrogen Cat#A31572; RRID:AB_162553 CD3 Monoclonal Antibody (17A2) eBioscience Cat#11-0032-82; RRID:AB_2572431 PE anti-mouse/human CD45R/B220 Antibody biolegend Cat#103028 CD45 Monoclonal Antibody (30-F11) eBioscience Cat#17-0451-82; RRID:AB_469392 Goat anti-Rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 Invitrogen Cat#A-11012; RRID:AB_2534079 Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 Invitrogen Cat#A-11001; RRID:AB_2534069 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell Signaling Technology Cat9664S; RRID:AB_2070042 Bacterial and virus strains Lactobacillus murinus Cultured anaerobically in Gifu Anaerobic Broth (GAM Broth) N/A Biological samples C57BL/6JGpt mice GemPharmatech N/A Chemicals, peptides, and recombinant proteins Gifu Anaerobic Broth (GAM Broth) Hopebio Cat#HB8518 PBS HyClone Cat#SH30256.01 Papain sigmaaldrich Cat#P3125-100MG DNase I coolaber Cat#CD4871 Collagenase I sigmaaldrich Cat#C0130-100MG Collagenase II sigmaaldrich Cat#C6885-100MG Collagenase IV sigmaaldrich Cat#C5138-100MG RIPA Lysis Buffer Beyotime Cat#P0013B PMSF Beyotime Cat#ST506 Protease Inhibitor Cocktail Beyotime Cat#P1010 SDS-PAGE Buffer Beyotime Cat#P0015 RPMI Medium 1640 GIBCO Cat#11875-093 MACS Tissue Storage Solution miltenyi Cat#130-100-008 Debris Removal Solution miltenyi Cat#130-107-677 Fluoromount-G SouthernBiotech Cat#0100-01 DAPI Fluoromount-G SouthernBiotech Cat#0100-20 TRIzolTM Reagent Invitrogen Cat#15596018 acridine orange Invitrogen Cat#A3568 propidium iodide invitrogen Cat#P3566 (Continued on next page) Cell Genomics 5, 100768, February 12, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fetal Bovine Serum (FBS) Gibco Cat#A5670701 Bovine Serum Albumin (BSA) sigmaaldrich Cat#A1933-25G dithiothreitol (DTT) solarbio Cat# D8220 EDTA-Na2 solarbio Cat# E8030 Neutral balsam solarbio Cat#G8590 Water suitable for HPLC sigmaaldrich Cat#270733-2.5L Methanol suitable for UHPLC sigmaaldrich Cat#1037261002 Paraformaldehyde, 4% solarbio Cat#P1110 optimal cutting temperature (O.C.T) sakuraus Cat#4853 DAPI beyotime Cat#C1002 enhanced chemiluminescence (ECL) substrate Easybio Cat#BE6706 Critical commercial assays Chromium Single Cell 30 Kit v2 10x Genomics Cat#CG00052 Adult Brain Dissociation Kit Miltenyi Biotec Cat#130-107-677 Modified Hematoxylin-Eosin(H&E) Stain Kit solarbio Cat#G1121 Deposited data scRNA-seq data This paper https://ngdc.cncb.ac.cn/search/ specific?db=biosample&q=PR PRJCA034312 Experimental models: Organisms/strains Chd8 mutant mice Nanjing Biomedical Research Institute of Nanjing University (NBRI) N/A Chd8 intestinal conditional knockout mice GemPharmatech N/A Cre-positive: C57BL/6JGpt-H11-Vil1-iCre GemPharmatech Cat#T004714 Chd8loxP: C57BL/6JGpt-Chd8em1Cflox/Gpt GemPharmatech Cat#T009485 Oligonucleotides Primers for genotyping, see Table S1 This paper N/A Software and algorithms Cell Ranger v3.1.0 10x Genomics https://support.10xgenomics.com/ single-cell-gene-expression/ software/downloads/latest scanpy v1.6.0 Wof et al.62 https://scanpy.readthedocs.io SCENIC v0.10.3 Van et al.64 https://github.com/aertslab/SCENIC MAST v1.14.0 Finak et al.65 https://rglab.github.io/MAST/ scrublet v0.2.2 Wolock et al.63 https://github.com/swolock/scrublet Scran v1.16.0 Lun et al.66 https://bioconductor.org/packages/ release/bioc/html/scran.html harmonypy v0.0.5 Korsunsky et al.67 https://github.com/immunogenomics/harmony scVelo v0.2.2 Bergen et al.38 https://scvelo.readthedocs.io/en/stable/ scCODA Buttner et al.68 https://sccoda.readthedocs.io/en/ latest/getting_started.html Augur Skinnider et al.25 https://github.com/neurorestore/Augur Cellchat v0.5.0 Jin et al.69 https://github.com/sqjin/CellChat GSEApy v0.10.1 Mootha et al.70 https://gseapy.readthedocs.io/ en/latest/index.html MSigDB Subramanian et al.28 https://www.gsea-msigdb.org/gsea/msigdb g:Profiler Raudvere et al.71 https://biit.cs.ut.ee/gprofiler/ PAGA Wolf et al.72 https://github.com/theislab/paga e2 Cell Genomics 5, 100768, February 12, 2025 OPEN ACCESS OPEN ACCESS
Incubation:Article Title: CDADC1 is a vertebrate-specific dCTP deaminase that metabolizes gemcitabine and decitabine to prevent cellular toxicity
Article Snippet: .. Sections were incubated with anti-CD3 (1:100, rabbit Mab, Abcam, #ab5690) and anti-Caspase 3 (1:100, Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb, Cell Signaling, t#9664S) for 60 min at RT. .. Biotin-conjugated secondary antibodies (goat anti-rabbit IgG, 1:200, Vector Laboratories) were detected using the Vectastain ABC kit (Vector Laboratories, PK-6100).
shRNA:Article Title: PI5P4Kα promotes glucose and iron acquisition to support metabolic fitness in pancreatic cancer.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PIP4K2A (D83C1) Rabbit mAb Cell signaling Technology Cat# 5527; RRID:AB_2722636 PARP (46D11) Rabbit mAb Cell signaling Technology Cat# 9532; RRID:AB_659884 p62/SQSTM1 (2C11) mouse mAb Abnova Cat# H00008878-M01; RRID:AB_437085 LC3A/B (D3U4C) Rabbit mAb Cell signaling Technology Cat# 12741; RRID:AB_2617131 Tubulin (TUBA1) mouse mAb Millipore Sigma Cat# T6199; RRID:AB_477583 Phospho-histone H3 (Ser10) Rabbit mAb Cell signaling Technology Cat# 9701; RRID:AB_331535 Cleaved Caspase-3 (Asp175) (5A1E) Rabbit mAb Cell signaling Technology Cat# 9664; RRID:AB_2070042 IRDye® 680LT Goat anti-mouse IgG secondary Ab LICORbio Cat# 926–68020; RRID:AB_2687826 IRDye® 800CW Goat anti-Rabbit IgG secondary Ab LICORbio Cat# 926–32211; RRID:AB_621843 Glut1 (E4S6I) Rabbit mAb Cell signaling Technology Cat# 73015; RRID:AB_3064908 ASNS Polyclonal antibody Proteintech Cat#14681-1-AP; RRID: AB_2060119 CD71 antibody, anti-human, PE, REAfinityTM, REA902 | AC102 Miltenyi Biotec Cat#130-115-029; RRID:AB_2726859 Bacterial and virus strains Lentivirus Produced using pLKO.1-puro shRNA system in HEK293T cells N/A DH5α E. coli Zymo research Cat# T3007 Biological samples Mouse pancreatic tumors Sanford Burnham Prebys Medical Discovery Institute vivarium N/A Human PDAC tissue samples University of Bern N/A Chemicals, peptides, and recombinant proteins Polybrene Santa Cruz Biotechnology Cat# SC134220 Formaldehyde 37% RICCA chemical company Cat# RSOF0010 Crystal violet Millipore Sigma Cat# C0775 Emricasan MedKoo Biosciences Cat# 510230 Tetramethylrhodamine, Ethyl Ester, Perchlorate (TMRE) ThermoFisher Scientific Cat# T669 Transferrin (human) CF® 594 Conjugate Biotium Cat# #00084 DAPI (4′,6-Diamidino-2Phenylindole, Dilactate) BioLegend Cat# 422801 Hoechst 33342 MP Biomedicals Cat# 0219030525 Doxycycline hyclate Millipore Sigma Cat# D9891 Sodium L-lactate Millipore Sigma Cat# 71718 Sodium pyruvate ThermoFisher Scientific Cat# 11360070 Dimethyl 2-oxoglutarate Millipore Sigma Cat# 349631 Dimethyl DL-Glutamate (hydrochloride) Cayman chemical Cat# 18602 Ammonium iron(III) citrate (FAC) Millipore Sigma Cat# F5879 Ferrostatin-1 Fisher Scientific Cat# 50-225-9214 Sodium citrate VWR Cat# 0101 Bafilomycin A1 Selleckchem Cat# S1413 DMEM with L-Glutamine and 4.5g/L glucose; without sodium pyruvate Corning Cat# 10017CV (Continued on next page) 16 Cell Reports 44, 116199, September 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mouse: Nude (Foxn1nu) The Jackson Laboratory Cat# 002019; RRID:IMSR_JAX:002019 Oligonucleotides PIP4K2A-F Custom DNA Oligos CGTAGCGCAGAAAGTGAAGC PIP4K2A-R Custom DNA Oligos GGCTCGGCATGTTTTCTTTGT Recombinant DNA pLKO.1 puro Addgene Cat# 8453 psPAX2 Addgene Cat# 12260 pVSV-G Addgene Cat# 138479 pCL-Ampho Novus biologicals Cat# NBP2-29541 pLKO.1 shSCR Addgene Cat# 17920 pLKO.1-puro-sh α1 Lab-generated sh α#1-TRCN0000220609; 5′- CCTCGGACAGACATGAACATT-3′ pLKO.1-puro-sh α2 Lab-generated sh α#2 -TRCN0000195145; 5′- CCAGCATCGTTCTAGCTATTT-3′ Tet-pLKO-puro Addgene Cat# 21915 Tet-pLKO-puro-sh α1 Lab-generated sh α#1-TRCN0000220609; 5′- CCTCGGACAGACATGAACATT-3′ Tet-pLKO-puro-sh α2 Lab-generated sh α#2 -TRCN0000195145; 5′- CCAGCATCGTTCTAGCTATTT-3′ mCherry-eGFP-LC3B NovoPro Cat# V012182 Software and algorithms GraphPad Prism version 10.0.0 GraphPad software RRID:SCR_002798; https://www.graphpad.com Fiji (ImageJ) NIH RRID:SCR_002285; https://fiji.sc BioTek Gen5 Agilent Technologies RRID:SCR_017317; https://www.agilent.com/en/ support/biotek-software-releases FACSDiVa v8.0.2.
|